Transcript asmbl_36431

Sequence
Transcript Sequence for observation asmbl_36431 of TGE0005280:
CGCCATTTTGTGGCTGCCTAGCGTCCGCCCGTGGCCGTCTGCGCAGGCGCGGCCGTGGCGTCGCGAGAATCCGGCTTCCACCCGCTGTGACGCTCCTGGGAGGCGGCGAAGCGCTCGGCCCGTCGCCATTGGGCTGGCCTTGCGGAGGGCGGGGCCGGCTCCACCCGCACTTCTCGGCCTTTCCTAACTGCGGCAGATGGGAGGGGGCCAGAAGAGCCGGGGAGAGTGAGGCTGCGCAGTTCCAGAGGCGGCAGTGGGCGTTGCGGTTGCTGCGTTCTGGGCCCAGGGAAGGATCGTGTTGGGAGCCGAGTTTTAATTTTGTCTGCAAGGGACCTGGCCTAATAAGAGGCACTCTTGGCAATCTTGTTTATAACATCACCCGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGG