Transcript asmbl_36430

Sequence
Transcript Sequence for observation asmbl_36430 of TGE0005280:
GCTAAGTGCGTCAGTTGTGGACAGACGTAGGCGAGTTGTGTCCTGGTCTGCGGGGAGGTAGAGGACTCCGTCGCAGACTACGGACCTCTCTTGGGTCTCAGCTGCCAAAGATCCTGTCCGGTAGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGG