Transcript asmbl_36382

Sequence
Transcript Sequence for observation asmbl_36382 of TGE0021780:
CCGTGCCGCACTGTAGGGAGTCGAACCTCGATTTTGGCGGTATCCTTTGTGGGCAGCGGACTAATAAAGGTCATGGCGCCGGCGGAAATCTTGAACGGGAAGGTGGTCTCCGCGCAAATAAGGGAGCGACTGAAGAACCAAGTCACTCAGATGAAGGAGCAAGCACCTGGTTTTATTCCAGGTCTGGCAATTTTACAGGTTGGCAACAGAGATGATTCCAATCTTTATATAAATGTGAAGCTGAAGGCTGCTGAAGAGATTGGGATCAAAGCCACTCACATTAAATTACCAAGAACGGCCACAGAATCTGAGGTGTTAAAGTACGTAACGTCTTTGAATGAAGACCTCACCATACATGGCTTCATAGTGCAGCTACCTTTAGATTCAGAGAATCCCATTAACACTGAAGCAGTGGTCAATGCTATTGCACCTGAAAAGGATGTGGATGGATTGACAAACATCAGTGCTGGAAAACTTGCTAGAGGTGACCTAAATGACTGTTTCATCCCTTGTACACCTAAAGGATGCTTGGAACTCATCAAGGAGACAGGGGTACAGATTGCCGGAAGGCACGCTGTGGTTGTCGGACGCAGTAAAATAGTCGGTGCCCCCATGCATGACTTGCTTCTGTGGAACCATGCCACAGTGACCACCTGCCACTCTAAGACGGCCAATCTAGACAAGGAGGTAAATAGGTGACATCCTGGTGGTTGCTACTGGTCAGCCTGAAATGGTAAAAGGGGAGTGGATCAAACCTGGGGCAATAGTCATCGACTGTGGAATCAATTACGTCTCAGACGATACAAAACCAAATGGGAGAAAAGTTGTGGGCGATGTGGCATACAGTGAGGCCAAAGAGAGGGCAGGCTTCATCACTCCTGTTCCTGGTGGCGTTGGGCCCATGACAGTGGCAATGCTAATGCAGAGCACAGTAGAGAGTGCAAATCGTTTCCTGGAGAAATTTAAGCCAGGAAAGTGGCTGATTCAGTATAACCACCTTAACCTCAAGACACCTGTTCCAAGTGACATTGATATATCACGATCCTGCAAGCCAAAGCCCATTCGTAACCTGGCTCGAGAAATTGGTCTGTTCTCTGAAGAGGTAGAATCTTATGGTGAAACAAAGGCCAAAGTCCTGCTGTCCGTGCTGGAACGCCTGAAGCAGCAGCCCGATGGGAAATACGTAGTGGTGACTGGAATAACTCCAACACCCCTGGGAGAAGGGAAAAGCACGACCACAATTGGGCTGGTGCAAGCCCTTGGCGCCCACCTCCATCAGAATGTCTTTGCATGTGTACGACAGCCTTCTCAGGGCCCCACCTTTGGAATAAAAGGTGGTGCTGCAGGTGGTGGCTACTCTCAGGTCATTCCTATGGAAGAGTTTAATCTCCACCTCACTGGTGACATCCACGCCATCACTGCAGCTAATAACCTCGTTGCCGCGGCCATTGATGCCCGAATGTTCCATGAACTGACCCAGACTGACAAGGCTCTCTTTAATCGTTTGGTACCATCAATAAATGGAGTGAGAAAGTTCTCTGACATCCAAATACGAAGGTTACGGAGGCTAGGCATTGAAAAGACTGATCCTACCACACTGACAGATGAAGAGATAAACAGATTTGCAAGATTGGATATCGATCCAGAAACCATAACTTGGCAAAGAGTGTTGGATACCAATGATCGATTCCTGAGGAAAATCACAATTGGACAGGCTCCAACGGAGAAAGGGTACACACGGACGGCCCAGTTTGATATCTCTGTAGCCAGTGAAATCATGGCTGTCCTGGCTCTTACCAGTTCCCTAGAAGACATGAGAGAGAGATTGAGCAAAATGGTGGTAGCATCGAGCAAGAAAGGGGAGCCCATCAGTGCCGAAGATCTGGGAGTGAGTGGTGCGTTGACGGTGCTTATGAAAGATGCAATCAAGCCCAATCTCATGCAGACCTTAGAGGGCACTCCAGTGTTTGTTCATGCTGGACCGTTTGCCAACATTGCACATGGGAATTCCTCTACCATTGCAGACCGGATTGCACTCAAGCTTGTTGGCCCTGAAGGGTTTGTAGTGACTGAAGCGGGATTTGGAGCAGACATTGGAATGGAAAAGTTTTTTAACATCAAATGCCGGTATTCTGGTCTCCGCCCTCACGCAGTGGTGCTTGTTGCCACTGTCAGGGCTCTTAAAATGCATGGAGGCGGCCCCACGGTTACTGCTGGACTGCCTCTTCCCAAGGCTTACATAGAGGAGAATTTGGAACTGGTTGAAAAAGGTTTCAGTAACTTGAGGAAACAAATCGAAAATGCCAGAACGTTTGGAGTTCCAGTAGTAGTGGCCGTGAATGCATTCAAGACAGATACGGAGGCCGAGCTAGACCTCGTCAGCCGCCTTGCCAAAGAACATGGGGCTTTTGATGCCGTCAAGTGCACTCACTGGGCAGAAGGGGGCAAGGGCGCCTTAGCCCTGGCTCGAGCCGTCCAGAGAGCAGCTCAGTCACCCAGCAGCTTCCAGCTCCTTTATGACCTCAAGCTCCCAGTTGAGGATAAAATCAGGATCATTGCACAGAAGATCTATGGGGCAGATGACATCGAACTGCTCCCCGAAGCTCAGCACAAAGCAGAAGTCTACACAAAGCAGGGCTTTGGGAATCTGCCCATCTGCATGGCCAAAACACACTTGTCCTTGTCTCATAATCCAGAGCAGAAAGGTGCGCCCACAGGCTTTGTCCTGCCCATTCGTGACATCCGTGCCAGCGTTGGGGCTGGTTTTCTGTACCCCCTCGTAGGAACGATGAGCACAATGCCTGGACTCCCTACCCGGCCCTGTTTCTATGATATTGATTTGGACCCTGAAACTGAACAGGTGAATGGGCTGTTTTAAACAGATTGTTCATCTTTAAGAAGCTACTTCGAAGGTTCGGCCAGCGTGTATTCAGGCCTGCTGTCACTTAGGAAATGTGGGAAAACGGAGAGAAGTCAGCCCCTGCCCTGAAGACCTTCTGAAATAAATAGTGGGATTTCCCCAGAAGCCCTTTCTCTGGTCATAATTCCTGTCATCATGTATAAATGAACATAAATCATGCACATGTCTATTTACTTTACTGAAATTCCACAGAATAAAAGAAATGATTTTGCTATCTCAGTGTTTA