Transcript asmbl_35146

Sequence
Transcript Sequence for observation asmbl_35146 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGTGACGACTTACTCCCGGCAGGGACTGAGGATTACATCCATATAAGAATCCAGCAACGGAACGGCAGGAAGACACTGACCACTGTTCAGGGCATCGCAGATGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGTAATGGTACTGTGATTGAACATCCTGAATACGGAGAGGTTATTCAGCTTCAAGGTGACCAAAGAAAAAACATTTGCCAATTTCTGTTGGAGGTTGGCATTGTCAAGGAGGAACAGCTTAAGGTTCATGGATTCTAAAATGAACCTAGATACGTGGAGAATTTCTTGAATAATTTTGTTCTCTAAATCCAGTTTGGCTGCCTTGTGAAATGATTCTCTGCAGTAAACGGACTTTTCATTTATTTAATCATTCAGATTTCCATTTACATCTGCATGACTACAGAAAACATGGGGTATGTAGGCTAGTAACACATAAGAAAATTGCAGTAAGATGGTAATGAAACCCCGTATTCATCTTAACATGTTTCCAATGGAAAATATTTTGTTTTGAGTGTTTATTTGTTTATTGTTCAGTTTATTACTTTTCACTTGATTAAATGTTTTTTTGTTGTATTAAACCATGTATGTTGCAGCTTAACAATAAAAATATGAATTCTTTTGTGAGCAGTTAGGCTCCCAAATTTAAGCAAGTAAGATACCCATACATTTTGTCTTTCATAATTGGAGTTCTCATTCTGAAAGTATTCTAATTAGATTCAGCTGCTGTTAAACCCAAAGCTAGAAGAGAACCTTTGTTAAAAGTAGCTTGTGTTCTTCATTTACTGACTTAAAATAAGAATAGAATCGCGTATAAACTCAGCTAGAGCCAAGAATCTGTCACAGTGTTAAATTTTAAAAAATAATGTGAAGTATAATTTAAACTTAAGTATTAGCACATAGAATTATTTTCTGTGTCTTTATTGGTTATGTCACTGGGCTGCCAAAATAAGTCTATCCCTAAGTGCCAGATAATGTAATAGACTTTCAACATAAATAAATTTAGTCACAGGCACTGCTTTGCAAGTGTGGGTGACGATGCCACCCTACAGCTGGAAGATACTGGGGTTCAAGTTAACTTCCCTTGAGTGCTAGAAAGTGACAGTTGGGATGCCAGCCCAGGGCTTCCAGCCAGAAAAGCCATGTTCTTTCACTACATCCTGGTGTCAGTGTGTGTTTCACCGAAGGAAGTGAGAGCCGCGGGTGGTGGTGCATAGCGGCTGGGTGTTGTGTGAGAAAGAGGATTTGCAGTTCTTAGCTCTGAGATCTTTGCAGCGCATCTTTTTGAGTTCCAAACTCACGCTTTTTATTGAGCAGTAATCAAGATGTGTCATTAAAGCCATTTAGCCAAGATGAAGAAATGCATCCACAAGTGCATACTTTTCAGCCGCTGCAGCGGCACGATGGCAGTGTGACAGCGTCTCGCTGTGCACCAGTGCAGTCTGTACCAGCTGAGCCCGGGCCCCTATTCTGATAAAACTGCTTTTGGAAAAACAGACTCAGCCCCCACAGATTTACCTCTTAAAGACACTTAAGTAATCGGTTTTGTTACTTTCTTACCCCATCCTACCTCTAATCAAGAAAGACAGACAGACTTAAGTGACTATACCATAATAGAGTGTCAAATTTGGTAAGCTCATTTCTGGAAAAGCATA