Transcript asmbl_351

Sequence
Transcript Sequence for observation asmbl_351 of TGE0005208:
CCCTGGAGGCCGACCACGTCCAGCGCGGGCCCCACTGGGCCGCTGCCTTAGACGGAGGAATCCGCCAGCAACGAGGAACCCACAGGCCTGAGGGTAATTTTGTGTGTATTGGAGACCAGACCTGAAGCACTTCTGAATTTAAGATCCCCGATTCTTCGAGGCGGCATTGGACAGCGCTAAGATCAGAAGATGAGTGAACTTGACCAGTTACGGCAGGAGGCGGAGCAGCTTAAAAACCAAATCAGAGATGCTAGAAAAGCGTGTGCAGATGCAACTCTCTCTCAGATCACGAACAACATCGACCCAGTGGGAAGAATCCAGATGCGCACCAGGAGAACGCTGAGGGGGCACCTGGCCAAGATCTACGCCATGCACTGGGGCACGGACTCCAGGCTTCTCGTCAGTGCCTCCCAGGATGGCAAACTCATCATCTGGGACAGCTACACCACAAACAAGGTCCACGCCATCCCTCTGCGTTCCTCGTGGGTCATGACCTGTGCTTATGCCCCGTCTGGGAACTACGTGGCCTGCGGTGGCCTGGACAACATTTGCTCCATTTACAATCTGAAAACTCGAGAAGGGAATGTCCGCGTGAGTCGGGAGCTGGCCGGACACACAGGTTACCTGTCCTGCTGCCGCTTCCTGGACGACAATCAGATTGTCACCAGCTCTGGAGACACCACCTGTGCTCTGTGGGACATCGAGACCGGCCAGCAGACGACCACATTTACCGGGCATACCGGGGATGTTATGAGCCTCTCGCTCGCTCCTGACACCAGGCTGTTTGTCTCTGGTGCTTGCGATGCTTCAGCCAAACTCTGGGATGTGCGAGAAGGGGTGTGCCGGCAGACCTTCACCGGCCACGAGTCCGACATCAACGCCATCTGCTTCTTTCCAAATGGCAATGCGTTTGCCACTGGCTCGGATGATGCTACCTGCAGGCTGTTTGACCTCCGTGCGGACCAGGAGCTCATGACTTACTCCCATGACAACATCATCTGCGGGATCACCTCCGTCTCCTTCTCCAAGAGCGGGCGCCTCCTCCTCGCAGGGTACGACGACTTCAACTGCAACGTGTGGGACGCGCTCAAGGCCGACAGGGCAGGTGTCTTGGCTGGGCACGACAACCGCGTGAGCTGCCTGGGGGTGACTGATGACGGGATGGCTGTGGCCACGGGGTCCTGGGATAGCTTCCTCAAGATCTGGAACTAACGCCGACAGGTAACGAGCAGCCCAGGGGCCCTTCCCTGCAGGTGCCTCTGCGTCATTGTCCTAACACCTGAGGTGCGCGGTCGTGGTTTCCAGACCGAGTCTGAGGTAGAGCTGACGGGGAATCGTGGTA