Transcript asmbl_34881

Sequence
Transcript Sequence for observation asmbl_34881 of TGE0005201:
AAAACCCAACTTCATAATATTGAAGAAAACCAGCTAGTATAAAATAGGAGGTGATGGATGGAAGATAAAATGTTTTTTAGAAAGTAGCTTTCATTTATATGCTCTGTCTCTTTCTCTTCTGTCCTGTTCCTCCCCACCCCCTTCTCCAACACACACACTCTCCCAAAAAGGATGTTCCCCTTCTACAGCTGCTGGAGGACTAGATTACTGCTGCTGCTACTGCTGGCTGTGACGGTGAAAGAATCCTGGCAGGCAGAAGAGAAAACCTGTGACCTGGTAGGAGAAAAAGGTAGAGAGTCAGAGAAAGAGTTGGCTCTACTGAATAGGATGAAACCACTGTATAACAAAAGCTTTGAGAGCACTGTGGGCCAGGGCCCAGACAAGTATATGTACATATTCAGAGTGTGCCGAGAAGCTGGCAACCACACCTCTGGGGCAGGCCTGGTGCAGATCAATAAAAGTAATGGGAAGGAGACAGTGGTGGGGAGACTCAACGAGACTCACATCTTCAATGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAATCACTGTGGCAGGGAGCAGCGCCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGAGGCAAAATCCAAGATTGTTTATACCTCTTTGAGATGGATAGTAGCCTGGCCTGTTCTCCTGAGATCTCCCACCTCAGTGTGGGTTCTATCTTACTTGTCACGTTTGCATCTCTGGTTGCTGTCTATATCATCGGGGGGTTCCTATACCAGCGACTGGTGGTAGGAGCCAAAGGAATAGAGCAGTTTCCTCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGTTGCGACTTCGTGTGCCGTTCTAAACCTCGAAATGTGCCTGCTGCATATCGTGGTGTGGGGGATGATCAGCTGGGGGAGGAATCAGAAGAAAGGGATGATCATTTATTACCAATGTGATTGCACTTTAAATGCCCAGCTTCTTCAGCCCCCCGCCCAGACCAAAGCATACTCAGCCAGATTTCTGAAGCAATCTCTCTACTCCAGTCTCTCCTCTCACCCTTAATGTTGCTCTTGCTTTCCAGTTTGCTTTTGGTTTGCATCCTCTTCTCACTAGTTGATATGCCTTCCCTTTTTCCTTATTTTTGGTTTTTCCTCAAGAGGTAGAGTTGTAGGTCAGAGGTTAACAGGGCCAGTGACAAGAGGCTATTGCACTGTCTTGGTACAGGAGGGTACAGTTAGGATCATTTTAATGAGCAAAAGCATGTGGCAGGCTTGCTGACCCTTTTTTAAACACATTTTCACAAGTTCTTGAGACACTGGATTTCTTTAATT