Transcript asmbl_34880

Sequence
Transcript Sequence for observation asmbl_34880 of TGE0005201:
CCCAGAGTGGAGCACCGCGAGGCGCTGAGGGGAACGCTGGCTGTGACACGAGCTCTGGGACTGGGGTCTGTGGCTGGCCCCTCGCTGGCCCTGTCTCCCAGCCCCAGACAGGTACTCACCTGGGGAGTCTGAGCTTTGGCTACTCCCTTTGCCCGTGACACGATGTTCCCCTTCTACAGCTGCTGGAGGACTAGATTACTGCTGCTGCTACTGCTGGCTGTGACGGTGAAAGAATCCTGGCAGGCAGAAGAGAAAACCTGTGACCTGGTAGGAGAAAAAGGTAGAGAGTCAGAGAAAGAGTTGGCTCTACTGAATAGGATGAAACCACTGTATAACAAAAGCTTTGAGAGCACTGTGGGCCAGGGCCCAGACAAGTATATGTACATATTCAGAGTGTGCCGAGAAGCTGGCAACCACACCTCTGGGGCAGGCCTGGTGCAGATCAATAAAAGTAATGGGAAGGAGACAGTGGTGGGGAGACTCAACGAGACTCACATCTTCAATGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAATCACTGTGGCAGGGAGCAGCGCCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGAGGCAAAATCCAAGATTGTTTATACCTCTTTGAGATGGATAGTAGCCTGGCCTGTTCTCCTGAGATCTCCCACCTCAGTGTGGGTTCTATCTTACTTGTCACGTTTGCATCTCTGGTTGCTGTCTATATCATCGGGGGGTTCCTATACCAGCGACTGGTGGTAGGAGCCAAAGGAATAGAGCAGTTTCCTCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGTTGCGACTTCGTGTGCCGTTCTAAACCTCGAAATGTGCCTGCTGCATATCGTGGTGTGGGGGATGATCAGCTGGGGGAGGAATCAGAAGAAAGGGATGATCATTTATTACCAATGTGATTGCACTTTAAATGCCCAGCTTCTTCAGCCCCCCGCCCAGACCAAAGCATACTCAGCCAGATTTCTGAAGCAATCTCTCTACTCCAGTCTCTCCTCTCACCCTTAATGTTGCTCTTGCTTTCCAGTTTGCTTTTGGTTTGCATCCTCTTCTCACTAGTTGATATGCCTTCCCTTTTTCCTTATTTTTGGTTTTTCCTCAAGAGGTAGAGTTGTAGGTCAGAGGTTAACAGGGCCAGTGACAAGAGGCTATTGCACTGTCTTGGTACAGGAGGGTACAGTTAGGATCATTTTAATGAGCAAAAGCATGTGGCAGGCTTGCTGACCCTTTTTTAAACACATTTTCACAAGTTCTTGAGACACTGGATTTCTTTAATT