Transcript asmbl_33798

Sequence
Transcript Sequence for observation asmbl_33798 of TGE0005119:
AGGAAACTTGAACGTAACTTCAAAAGAAGATTTGATTTTTTTGTATCTGGATCACGTATATACAGCAAGACCGTCAGAATGTCGGGAGCCTCAGTGAAGGTGGCTGTCCGCGTGCGGCCCTTCAATTCTCGAGAGACCAGCAAAGAGTCCAAGTGCATCATTCAGATGCAAGGCAACTCCACCAGTATTGTTAACCCAAAGAACCCAAAGGAAGCTCCAAAGTCCTTCAGCTTTGACTACTCCTACTGGTCTCACACCTCGCCAGAAGATCCCTGTTTTGCATCTCAAAACCGAGTGTACAATGATATTGGAAAGGAAATGCTCTTACATGCTTTCGAGGGATATAATGTCTGTATTTTTGCCTATGGGCAGACTGGTGCTGGGAAATCTTACACGATGATGGGTAAACAAGAAGAAAGCCAGGCTGGCATCATTCCACAGCTGTGTGAAGAACTATTTGAGAAAATCAATGACAACTGTAATGAAGACATGTCTTACTCTGTAGAGGTGAGCTACATGGAAATTTACTGTGAAAGGGTACGCGATTTGCTGAATCCAAAAAACAAGGGTAATTTGCGCGTGCGTGAGCACCCACTTCTTGGCCCGTATGTGGAGGATCTGTCAAAGTTGGCAGTCACTTCCTACACAGACATTGCTGACCTCATGGATGCTGGGAACAAAGCCAGGACAGTGGCAGCTACCAACATGAATGAAACAAGTAGCCGTTCCCACGCTGTGTTTACAATTGTTTTCACCCAGAAGAAACATGACGCCGAGACCAACCTTTCCACTGAGAAGGTCAGTAAGATCAGCTTGGTGGATCTAGCGGGAAGTGAACGAGCTGACTCAACTGGTGCCAAAGGGACTCGATTAAAGGAAGGAGCAAATATTAATAAGTCTCTTACAACTCTGGGCAAAGTCATTTCAGCCTTGGCAGAGGTGAGTAAGAAGAAGAAGAAAACTGATTTTATTCCCTACAGGGATTCTGTACTTACTTGGCTCCTTCGAGAAAATCTAGGTGGCAATTCTCGGACTGCCATGGTTGCTGCCCTGAGCCCAGCAGATATCAACTATGATGAAACTTTGAGCACTCTGAGGTATGCAGATCGTGCAAAGCAGATTAAATGCAATGCTGTTATCAATGAGGACCCCAATGCCAAGCTGGTCCGTGAACTAAAGGAGGAGGTGACGCGGCTGAAGGATCTTCTTCGTGCTCAGGGCCTGGGAGACATCATCGATACGTCCATGGGGTCCCTTACTTCATCTTCATCTTCCTGCTCACTCAATAGTCAGGTGGGCTTAACATCTGTGACCAGTATTCAGGAGAGGATCATGTCTACCCCCGGAGGAGAGGAAGCCATCGAACGTCTGAAGGAGTCTGAGAAGATCATTGCTGAGTTGAATGAAACCTGGGAAGAGAAGCTGCGTAAAACAGAGGCCATCAGAATGGAGAGAGAGGCCTTGTTGGCTGAGATGGGCGTTGCCATCCGGGAAGATGGAGGAACCCTGGGCGTTTTCTCACCTAAAAAGACCCCACATCTCGTTAACCTCAATGAGGACCCACTAATGTCGGAATGCCTGCTTTATTACATCAAGGATGGACTTACAAGGGTCGGCCAGGCGGATGCCGAGAGGCGCCAGGACATCGTGCTGAGTGGGGCGCACATTAAAGAAGAGCATTGTGTCTTCCGGAGCGAGAGGAGCGACAGCGGGGATGTTATCGTGACGCTAGAGCCCTGTGAACGCTCAGAAACCTACGTAAATGGCAAGAGGGTGGCCCAGCCTGTTCAGCTGCGTTCAGGAAACCGTATCATCATGGGTAAAAACCACGTGTTTCGTTTTAACCACCCCGAGCAAGCACGGGCTGAGCGGGAGAAGACACCCTCTGCCGAGACCCCCTCTGAGCCTGTGGACTGGACGTTTGCCCAGAGAGAGCTTCTGGAAAAACAGGGGATTGATATGAAACAGGAGATGGAGAAAAGGTTACAGGAAATGGAGATCCTGTACAAAAAGGAGAAAGAGGAAGCAGACCTTCTCCTGGAGCAGCAGAGACTGGACGCGGATTCTGATAGCGGGGATGATTCTGACAAGAGGTCCTGCGAAGAGAGCTGGAAACTGATTACTTCTTTGAGAGAAAAGCTACCTCCCAGCAAGTTGCAAACCATTGTTAAAAAATGTGGCCTCCCGAGCAGTGGGAAGAAACGGGAACCAATTAAAATGTACCAGATACCCCAAAGAAGGCGCCTCAGTAAAGATTCCAAGTGGGTCACCATCTCAGACCTTAAGATTCAGGCCGTCAAAGAGATTTGCTACGAGGTGGCGCTCAACGATTTTAGGCACAGTCGGCAGGAGATCGAAGCCTTGGCCATCGTTAAGATGAAAGAGCTTTGCGCCACGTACGGGAAGAAAGATCCCAACGAGCGGGACTCCTGGAGGGCGGTGGCCAGGGATGTCTGGGACACCGTGGGAGTAGGCGACGAGAAGATCGAAGATGTGATGGCCAGTGGTAAAGGCGGAACCGACGTGGATGACCTCAGGGTTCACATAGACAAGCTGGAAGATATTTTGCAAGAGGTCAAAAAGCAAAATAACATGAAAGACGAGGAGATAAAAGTCTTAAGAAATAAAATGCTCAAAATGGAGAAAGTCTTGCCACTGATCGGGTCGCAGGAACAGAAGACCCAAGGAAACCATAAAGCGAAGGAACCTGTCGGTGCCGGCGTCAGTAGCAAGTCTGAGAATGACGTCAGTAAAGGAGACGGTGGGGAGCTTGGGTTGTTTCCCAGCTGATGAACGGGGACCCAGCTTTCCGACGTGGACGTCTGCGCTGGATGAGGCAGGAGCAGATCCGGTTCAAGAACCTGCAGCAGCAGGAGATAACAAAGCAGCTTCGTCGGCAGAACGTGCCCCATAGGTTCATCCCTCCTGAGAACCGGAAGCCCCGCTTCCCCTTTAAGAGCAATCCTAGACACAGGAACTCTTGGAGTCCTGGCACACACATCATCATAACGGAAGACGAGGTTATAGAGCTTCGAATACCGAAGGATGAAGACGGAAGGAAAGGAAATAAAGAGGAGAGCCAAGAGAAGGGTGGTAGAGCAGCTTCTAAGGACCCCCAGTTACCATGGGGCTCTCAGGTCACC