Transcript asmbl_33785

Sequence
Transcript Sequence for observation asmbl_33785 of TGE0005114:
GTGGGAGAGGACGACGGCCGGCGAGGGGAGGAGGCGGCCCTAGCGCCATTTTGTGGGAGCGAAGCGGTAGCTGGGCTGCTCCTGGATCCCTGGCTGCTCCGCGTCTCCGTGTCGGGCTTCCTAGCAGCAGCCTAGCGGAAAAATAAAAGATGTCTGAATATATTCGGGTAACCGAAGACGAGAATGATGAACCCATCGAAATACCATCAGAAGACGATGGGACAGTACTGCTTTCCACAGTTACAGCTCAGTTTCCAGGGGCCTGTGGGCTGCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTGGAAGGAATTCTGCATGCCCCGGATGCTGGCTGGGGAAATCTGGTATATGTTGTCAACTATCCCAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTTCAGAAAACATCTGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACTGAACAAGATCTAAAAGAATATTTTAGTACCTTTGGAGAAGTTCTTATGGTTCAGGTCAAGAAAGATATTAAAACTGGTCATTCAAAAGGCTTTGGCTTTGTTCGATTTACGGAATATGAAACCCAGGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGTAAACTTCCTAATTCTAAGCAAAGCCCAGATGAACCTTTGAGAAGCAGAAAGGTGTTCGTTGGGCGTTGTACGGAGGACATGACTGCTGATGAGTTGCAGCAGTTCTTCTGCCAGTATGGAGAAGTGGTAGATGTCTTCATTCCCAAACCGTTCAGGGCTTTTGCCTTTGTTACATTTGCAGATGATCAGGTTGCCCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTACATATATCCAATGCTGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTCGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAACAGTAGGGGGGGCGGAGCTGGCTTGGGAAACAATCAAGGTAGTAATATGGGTGGGGGGATGAACTTTGGTGCTTTTAGCATTAATCCAGCAATGATGGCTGCAGCCCAGGCAGCACTGCAGAGCAGCTGGGGTATGATGGGCATGCTAGCCAGTCAGCAGAATCAGTCAGGCCCATCAGGTAATAACCAAAGCCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTTGGTTCTGGAAATAATTCTTATAGTGGTTCTAATTCAGGTGCAGCAATTGGTTGGGGATCAGCATCAAATGCAGGGTCAGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAACCTTCTAGCTGGGGAATGTAGACAGTGGGCGATGGTTGTATAGACTGGTGGGAATTCAAATTTTTCTAAACTCATGGTAAGTATATTGTAAAATACATATGTACTAAGAATTTTCAAAATTGGTTTGTTCAGTGTGGAGTATATTCAGCAGTATTTTTGACATTTTTCTTTAGAAAAAGAAGAAGAGCTAAAGGAATTTTATAAGTTTTGTTACATAAAGGGTTGAAATATTGAGTGTTTGAAAGTGAACTGCTGTTTGCCTGATTGGTAAACCAACACACTACAATTGATATCAAAAGGTTTCTCCTGTAATATTTTATCCCTGGACTTGTCAAGTGAATTCTTTGCATGTTCAAAATGGAAACCATTGATTAGAACTACATTGTTTTCTCCTTGTTTTAATTTGAACCCCACCGTATGGATTTTTTTCCTTAGGAAAACTCTCCGTTTTGGAGATCATGGTGTCACAGTGTTTGGTTCTTTTGTTTGTTTTTTAACACTTGTCTCCCTTCATATACAAAAGTACAATATGAAGCCTTCATTTAATCTCTGCAGTTCATCTCATTTCAAATGTTTATGGAAGAAGCACTTCATTGAAAGGAGTGCTGTAAATGCTCTGCCATAGGAATCCTTCCGCCTACATGCTTTCTCATTCAGGAATTTGTCATCACGCTGCACAGGCTGCGTCTTTGACGGTGGGTGTCCCATTTTTATCCGCTACTCTTTATTTCATGGAGTCGTATCAACGCTATGAACGCAAGGCTGTGATATGGAACCAGAAGGCTGTTTGAACTTTTGAAACCTTGTGTGGGATTGATGGTGGTGCCGAGGCATGAAAGGCGAGTATGAGCGAGAAAAGGAGAGCGCGTGCAGAGACTTGGTGGTGCATAATGGATATTTTTTAACTTGGCGCGATGTGTCTCTCAATCCTGTGGCTTTGGTGAGAGAGTGTGCAGAGAGCAATGATAGCAAATAATGTACGAATGTTTTTTGCATTCAAAGGACATCCACCTCTGTTGGAAGACTTTAAGTGAGTTTTGTTCTTAGATAACCCACGTTAGTTGAATGTGTTAAGTGAAACGATACTTGTATTTCCCCTACCCCTTTGTCAACTGCTGTGAATGCTGTATGGTGTGTGTTCTCTTCTGTTACTGACCTGTAAGTGTGGTAATGTGAACTGAAGCTGATGGGTTGAGAACATGGACTGAGCTTGTGGTGTGCTTTGCAGGAGTACTTGGAAGCAGAGTTCACCAGTGAGCTGGGGGTGTCTCAAAGAAGGGTGGAAGTTCTAATGTCTGTTAGCTACCCATAAGAATGCTGTTTGCTGCAGTTCTGTGTCCTGTGCTTGGATGCTTTTTATAAGAGTTGTCAATGTTGGAAATTCTTAAATAAAACTGATTTAAATAATATGTGTCTTTGTTTTGCAGCCCTGAATGCAAAGAATTCATAGCAGTTAATTCCCCTTTTTGACCCTTTTGAGATGGAACTTTCATAAAGTTTCTTGGCAATAGTTTATTTTGCTTCAAATAAACTTATTTGAAAAGTTGTCTCAAGTCAAATGGATTCATCACCTGTCATGCATTGACACCTGATACCCAGACTTAATTGCTATCTGTTCTTGCATTGTCCAA