Transcript asmbl_32351

Sequence
Transcript Sequence for observation asmbl_32351 of TGE0005027:
AGCTCGGCTAGCCCCGCCCGTCGACTGTTGGGCCTTTACGCTCGGACCCCGGCCCTGGCTCGGGTTCCGCGAGGAAGCAGGAGCGAGGTTTTCCGGCTGGACGGGTTTGAGGATCCTCTTCGCTCCAGACCACCAGATAGAGCCTCAGGTTGCAGAATAGGAGCTCCAGAAAGCAACGTTTTACGGATGGGAGCTGCTCCTCGGGGGCTGAGCTTGTCAGCATCCTCCTACGGCCCTCGCCTCTGAAGTCAGAGAAGAGCCCCTACACCCACATCCCTCTTGTCCCGTTTTGGGGTCGCCTCCGTCTACCCGGTGCTTAGCCCTAGTGGCCTCCTTAGTCCGACAGAGGAGCAGGACGATGATACTGGCATCTGTGCTGGGGAGTGGCCCCCGGGGCGGGCCTCTGCTCCGTCCCTACCTGGGGCCTGCACTCTTGCTCCGGGCACGCTCCACATCAGCCACCGACACACATCATGTGGAGATGGCGCGGGAGCGCTCCAAGACCGTCACCTCCTTTTATAACCAGTCAGCCATCGACGTGGCAGCTGAGAAGCCCTCAGTCCGCCTCACTCCAACCATGATGCTCTATTCTGGCCGATCTCAAGACGGCAGCCACCTTCTGAAAAGTGCCCGGTACTTGCAGCAAGAGTTGCCAGTGAGGATTGCTCACCGCATCAAGGACTTCCGCAGCCTTCCTTTCATCATTGGCTGCAACCCCACCATACTGCACGTGCATGAGCTGTACATCTGTGCCTTCCAGAAGCTGACAGACTTCCCTTCGATCAAAGACCAGGCGGATGATGCCCAATACTGTCAGCTGGTGCGTCAGCTGCTGGACGACCACAAAGATGTGGTGACCCTCTTAGCTGAGGGCCTACGTGAGAGCCGGAAGCACATACAGGATGAGAAGCTTGTCCGCTACTTCTTGGACAAGACACTAACTTCAAGGCTTGGGATCCGCATGTTGGCCACACATCATCTGGCACTGCATGAGGACAAGTCTGACTTTGTTGGCATCATCTGCGCTCGTCTCTCACCAAAGAAGATTATTGAAAAGTGGGTGGACTTTGCCAGACGCCTGTGTGAGCACAAGTATGGCAATGCCCCCCGTGTCCGCATCAATGGACATGTAGCTGCTCGATTCCCCTTCATTCCAATGCCACTGGACTACATCCTGCCCGAGTTGCTCAAGAATGCCATGAGAGCCACGATGGAGAGTCACCTAGACACTCCCTACAATGTACCAGATGTGGTTATCACCATCGCCAACAATGATATCGATCTTGTCATCAGGATTTCAGACCGGGGTGGGGGAATTGCTCACAAAGACCTGGATCGTGTTATGGACTACCACTTCACTACAGCTGAGTCCAGCACCCAGGACCCCCGGATCAACCCACTCTTTGGCCACTTGGACATGCACAATGGTGGCCAGTCAGGACCCATGCATGGCTTTGGCTTCGGGCTGCCCACCTCACGGGCCTATGCGGAGTACCTTGGTGGTTCCCTTCAGCTGCAGTCCCTGCAGGGCATTGGCACAGATGTCTACCTGCGACTCCGTCACATCGATGGCCGGGAAGAAAGCTTCCGCATCTGATCCCACAGTCCTTGACCCTGCCCATCCCAGGCCACACACCCTGCTCCACACACTGCTGCATCTTGGGTCCTAGGACCCCAAATGGATGGACTTACATGGAGCCAGCGCCACCTCTCAACGGGGTCCACTGCTTACCTGCCTCCAGGCCTTGGTGGGGAAGTGGGGACACTTGAGGTCTCCAGCACCAGCTCCTTCCTCGTTCCTGAGGAACCCCATTTTGACCTGCTGTTTGTTAATTAAAGTTCA