Transcript asmbl_32348

Sequence
Transcript Sequence for observation asmbl_32348 of TGE0005027:
AGCTCGGCTAGCCCCGCCCGTCGACTGTTGGGCCTTTACGCTCGGACCCCGGCCCTGGCTCGGGTTCCGCGGTAAGTGGAGCAACCGTCGCAGACCTTGCCGGAGCGGGTTTTGCAGTGTGCGCCCACAGCCTCCGCCATTGTGCTGGACGCGGGGCTGGCATCTACCATATGGAGCGGGGGGGAATCCAGGCCGAAACAAGTGACCTGCGGAGGGGGAACCTAGATGGGGACTCCCGGGCTGCAGCTTCCATGCAGCCGGCACTCCGGCGCACAATGGGCGCACAATGCCGTGTGTCGCACATGGGAGCTGCTCCTCGGGGGCTGAGCTTGTCAGCATCCTCCTACGGCCCTCGCCTCTGAAGTCAGAGAAGAGCCCCTACACCCACATCCCTCTTGTCCCGTTTTGGGGTCGCCTCCGTCTACCCGGTGCTTAGCCCTAGTGGCCTCCTTAGTCCGACAGAGGAGCAGGACGATGATACTGGCATCTGTGCTGGGGAGTGGCCCCCGGGGCGGGCCTCTGCTCCGTCCCTACCTGGGGCCTGCACTCTTGCTCCGGGCACGCTCCACATCAGCCACCGACACACATCATGTGGAGATGGCGCGGGAGCGCTCCAAGACCGTCACCTCCTTTTATAACCAGTCAGCCATCGACGTGGCAGCTGAGAAGCCCTCAGTCCGCCTCACTCCAACCATGATGCTCTATTCTGGCCGATCTCAAGACGGCAGCCACCTTCTGAAAAGTGCCCGGTACTTGCAGCAAGAGTTGCCAGTGAGGATTGCTCACCGCATCAAGGACTTCCGCAGCCTTCCTTTCATCATTGGCTGCAACCCCACCATACTGCACGTGCATGAGCTGTACATCTGTGCCTTCCAGAAGCTGACAGACTTCCCTTCGATCAAAGACCAGGCGGATGATGCCCAATACTGTCAGCTGGTGCGTCAGCTGCTGGACGACCACAAAGATGTGGTGACCCTCTTAGCTGAGGGCCTACGTGAGAGCCGGAAGCACATACAGGATGAGAAGCTTGTCCGCTACTTCTTGGACAAGACACTAACTTCAAGGCTTGGGATCCGCATGTTGGCCACACATCATCTGGCACTGCATGAGGACAAGTCTGACTTTGTTGGCATCATCTGCGCTCGTCTCTCACCAAAGAAGATTATTGAAAAGTGGGTGGACTTTGCCAGACGCCTGTGTGAGCACAAGTATGGCAATGCCCCCCGTGTCCGCATCAATGGACATGTAGCTGCTCGATTCCCCTTCATTCCAATGCCACTGGACTACATCCTGCCCGAGTTGCTCAAGAATGCCATGAGAGCCACGATGGAGAGTCACCTAGACACTCCCTACAATGTACCAGATGTGGTTATCACCATCGCCAACAATGATATCGATCTTGTCATCAGGATTTCAGACCGGGGTGGGGGAATTGCTCACAAAGACCTGGATCGTGTTATGGACTACCACTTCACTACAGCTGAGTCCAGCACCCAGGACCCCCGGATCAACCCACTCTTTGGCCACTTGGACATGCACAATGGTGGCCAGTCAGGACCCATGCATGGCTTTGGCTTCGGGCTGCCCACCTCACGGGCCTATGCGGAGTACCTTGGTGGTTCCCTTCAGCTGCAGTCCCTGCAGGGCATTGGCACAGATGTCTACCTGCGACTCCGTCACATCGATGGCCGGGAAGAAAGCTTCCGCATCTGATCCCACAGTCCTTGACCCTGCCCATCCCAGGCCACACACCCTGCTCCACACACTGCTGCATCTTGGGTCCTAGGACCCCAAATGGATGGACTTACATGGAGCCAGCGCCACCTCTCAACGGGGTCCACTGCTTACCTGCCTCCAGGCCTTGGTGGGGAAGTGGGGACACTTGAGGTCTCCAGCACCAGCTCCTTCCTCGTTCCTGAGGAACCCCATTTTGACCTGCTGTTTGTTAATTAAAGTTCA