Transcript asmbl_32290

Sequence
Transcript Sequence for observation asmbl_32290 of TGE0021632:
GGTAAGATGAAAAGTGAGTTGGGCCACTCAGGACACCATCTCTCTGTCTACAGATTGGAGTAGAGCATGTGGTGGTATACGTGAACAAGGCAGATGCCGTCCAGGACTCTGAAATGGTGGAGCTAGTGGAGCTGGAAATCCGAGAACTGCTCACTGAATTTGGCTACAAAGGGGAAGAGACTCCAGTCATCATAGGCTCTGCCCTCTGTGCCCTTGAGCAACGTGACCCTGAACTAGGCCTGAAGTCTGTGCAGAAGCTGCTGGATGCTGTGGACACTCACATCCCGGTGCCCACCCGGGATCTGGAGAAGCCTTTCCTGTTGCCTATAGAGTCAGTTTACTCTATTCCTGGCCGGGGCACAGTCGTGACAGGTACGCTAGAACGTGGAATTTTGAAGAAGGGAGATGAGTGTGAATTCCTGGGACATAACAAGAACATTCGCACTGTGGTGACAGGCATCGAGATGTTCCATAAGAGCTTGGAGAGGGCAGAGGCAGGTGATAACCTTGGGGCCCTAGTTCGAGGCTTGAAGCGAGAAGACCTGAGGCGTGGCCTGGTCATGGCCAAGCCAGGTTCCATCCAGCCCCACCAGAAGGTGGAGGCACAGGTTTACATCCTCAGCAAAGAGGAAGGTGGCCGCCACAAGCCCTTTGTGTCCCATTTCATGCCTGTCATGTTCTCCCTGACTTGGGACATGGCCTGTCGTGTCATCTTGCCTCCAGGGAAGGAGCTTGCCATGCCTGGGGAGGACCTGAAGCTTAGCCTTATCTTACGGCAACCAATGATCTTAGAAAAAGGTCAGCGTTTTACCCTGCGAGATGGCAACCGGACCATCGGCACTGGCCTTGTCACTGACACACCAGTCATGACTGAGGAGGACAAGAATCTCAAGTGGAGTTGAGTCTGCACCTCTGCTCAGGCTCTTGAGTTCAGGGCTGCACTGGCCAGTGTTCGCTCCTTCTGGTGCCCCCTTCCCAGGGCATAGACTGTAACCTAGCAGTTGCGCTAGACTGACACTTTCCCTGCCAGAAGAGGCCATGTAGCCTGCCCGGTGAGGTAGGTCAATAAACTGTTCTGTGAATAGT