Transcript asmbl_32194

Sequence
Transcript Sequence for observation asmbl_32194 of TGE0021627:
CTTTATGCAGCGCCGGCCTTGGCGGGAGGGAATCCTTGGACATCGGGCTGTACCCCTGAGCTGGCGTGCCCCCAATCTCGGGGGGTTAGTTCCAGTCCGGGCGGCAGCAGATGCCAGGATCTCACTAACTGGCTGGTTTTTTTCGCTCTCTTCAGCAAATGGCGGATGACGCCGGTGCTGCGGGAGGGCCCGGAGGCCCCGGGGGCCCTGGGATTGGAGGCCGCGGCGGCTTCCGTGGAGGATTCGGCAGCGGCATCCGGGGTCGAGGTCGTGGCCGGGGTCGCGGCCGGGGCCGAGGCCGCGGAGCTCGCGGAGGCAAAGCTGAGGATAAGGAGTGGATTCCCGTCACTAAGTTGGGCCGCTTGGTCAAGGACATGAAGATCAAGTCTCTGGAGGAGATCTATCTCTTCTCCCTGCCAATCAAGGAATCTGAGATCATTGACTTTTTCTTGGGAGCATCTCTCAAAGACGAGGTTTTGAAGATTATGCCCGTGCAAAAGCAGACCCGTGCTGGTCAGAGGACCCGGTTCAAGGCATTTGTTGCCATTGGGGACTACAATGGACATGTCGGTTTGGGTGTCAAGTGCTCCAAGGAGGTAGCCACTGCCATCCGTGGGGCTATCATCCTGGCCAAGCTCTCCATTGTCCCTGTGCGGCGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACACCGTCCCTTGCAAGGTGACTGGCCGCTGTGGCTCTGTACTGGTGC