Transcript asmbl_31201

Sequence
Transcript Sequence for observation asmbl_31201 of TGE0004935:
CGCTCCCTGACCATCCCCTCCACGCCGCCCGCTGAAACCCAGCCAGAGCGCGTACTTGCACCCCGCCCCGTACTCTGACTCAGCAGTAGTCACCTTGTCCCGCCCGTGAAGCCGGAAAGTTCGCGATTCCGATAGCTTTGCGAGCGAGGTGGAGAGGGGACTTCAGAGACAGCACAGGTGATTTCACCCCTTTGCTTGTGAGTCATGGCAGCTCCCATGAAGAGCCAAGTGTGCGTGGTGACTGGTGCTTCCAGAGGTATTGGCCGTGGCATCGCCTTACAGCTCTGCCAAGCAGGTGCCACAGTTTACGTGACTGGCCGACATCTGGACACACTGCGGGCCACTGCTCAGGATGCACAATCCCGAGGGGGGCGGTGTATACCTGTGGTGTGCGATTCAAGCCAGGAGAGTGAAGTGCGAAGCCTCTTTGAGCAGGTGGCTCGAGAACAGGGGCGTCTGGATGTGCTGGTCAACAATGCCTATGCAGGGGTCCAGGCAGTCCTGAACAACATTAATAAAGCATTCTGGGAAACACCTGCCTCCTTCTGGGATGATATCAACAATGTTGGACTCAGAGGCCACTACTTGTGCTCGGTCTATGGGGCACGGCTGATGGTACCAGCTGGCCGGGGGCTCATCGTGGTCATCTCCTCCATTGGGGGGCTGAAATATCTAGCCAATGTCCCCTACGGCGTCGGTAAAGCTGCGTGCGACAGGTTGGCTGCTGACTGTGCCCTCGAGCTGCGGCGTCATGGGGTCAGCTACGTGTCTCTTTGGCCAGGATTGGTGCAAACAGAACTGCTGAAGGACTATTTGAGGAACAATGACAATGCTGAAGATTCTCTGCTTAAGCAGTTCTCGTCTGCGGAGACCACAGAAATGAGCGGAAAATGTGTGGTGGCTTTGGCAACAGACCCCAATATCTTGAGCCTGAGTGGAAAGGTACTGCCATCCTGTGACCTTGCTCGACGCTACGGCCTTCGGGATGTGGATGGCCGCCCCGTCTGGGACTATTTGTCTTTGAGCTCTGTTATCTCCCACGCCTCTAGCCTGGGCTGGCTGGCCTCCTACTTGCCTGGCTTCCTTCGTGTGCCCAAGTGGGTTATGACTCTCTACACTAGCAAGTTCTAACATTCTTGGCCTGATGTCACCACCCTGCTTGTCTTTTCAGTTGGCCTGGGTGGTTGGGCCTGTCTTAGTGGAACAAGGCAGCCTTTCCCGCCTTGCCCTTGATTCAAAGAGAAAGACTCTGCTACGTGTCCTGG