Transcript asmbl_14381

Sequence
Transcript Sequence for observation asmbl_14381 of TGE0000289:
CTGGTTATGACAGAGGCACATCTTCCCAGTCAGACTTTGGAACAGGGCCTTGATGTTTTAGAAATTATGAGAAACATTCATATATTTGTGTCCCGATACCTCTATAATCTCAACAATCAGATTTTTATTGAACGAACAAGCAATAACAAGCATTTGAATACTATTAATATTCGGCATATTGCTAATTCAATTCGAACACATGGCACGGGAATTATGAATACAACTGTTAATTTCACCTACCAGTTTTTGAAAAAGAAGTTCTATATATTTAGCCAATTTATGTATGATGAACACATCAAATCCAGATTGATTAAAGATATTCGATTTTTCAGGGAAATTAAGGACCAAAATGATCATAAGTATCCTTTTGATAGAGCAGAAAAATTCAATCGAGGCATCAGAAAACTTGGAGTAACACCTGAGGGACAGAGCTACCTTGATCAATTCAGGCAACTCATCAGCCAGATTGGTAATGCTATGGGCTATGTACGAATGATAAGATCTGGTGGTCTTCATTGTAGCAGCAATGCCATTAGATTTGTTCCTGATCTTGAAGATATTGTAAATTTTGAAGAACTAGTAAAAGAAGAAGGTCTTGCAGAAGAAACATTAAAAGCAGCAAGGCATTTGGATTCAGTCCTCAGTGATCACACACGAAATTCTGCCGAAGGCACAGAATATTTCAAAATGCTTGTAGACGTTTTTGCTCCAGAATTTCGAAGGCCAAAGAATATACATCTCCGAAATTTCTATATAATTGTTCCCCCTCTGACCCTCAACTTTGTAGAGCATTCCATTAGTTGCAAGGAAAAATTAAATAAAAAAAATAAAATTGGAGCTGCCTTTACTGATGATGGCTTTGCCATGGGTGTGGCTTACATTCTAAAGCTTTTGGATCAGTATCGGGAGTTTGATTCACTTCACTGGTTCCAGTCTGTTAGAGAGAAATACCTGAAGGAGATAAGAGCAGTTGCTAAGCAACAGAATGTACAGTCAGCCAGTCAAGATGAAAAACTCTTACAAACCATGAATCTCACTCAGAAGCGACTGGATGTCTATCTACAGGAATTTGAATTGCTGTATTTCTCACTGAGCAGTGCAAGAATTTTCTTCAGAGCAGACAAGACTGCGGCTGAAGAAAACCAAGAAAAGAAAGAGAAGGAAGAAGAAACTAAAACAAGCAATGGAGACCTGTCTGACAGCACTGTGTCTGCTGATCCTGTTGTGAAATGATACGGATGGTATTCACTGCACATATGATGAAATCATCAGAATTGTTAAAACTTTTGCCAGTGGAATGGATAAACTATTGATGAATTGTTTCCTGGGTCACATCTCTGGAAAATAGATGTTACAGTTCTTAAAGGCAGTGCTTTAAAGTGAAGTTCATTCTGTTTCCAAAGGCTCTACTTTCAAAGGTTAAGAATGAGATTTTAAAATTGGATTTTTGCCTGGACTTGAGGGTACAAGATGTTTCTATTTGAAGTGAAGTTATAAAAGGGCAAATCCAGATTCATAAACTATCACCTCGGATTTCTTGTAATCTACATGTTTGTAATTTGTATTTGCATAGATCTTTGATCTA