Transcript asmbl_30761

Sequence
Transcript Sequence for observation asmbl_30761 of TGE0004902:
GTCCGTGCTCCGCCTTCGAAGTCCGTGCTCCGCGCTAGGCCAGTGCCATGGCGGTAGTGGCGGCCCTTCTGCGCGGCTGTGTCCGCCGGTGCAGCCCCCTGCTTCGGCTACAGATGCAGGAAATAAGTTATGTAAAACGAAGTTATGTATCAAAACCCACTTTGAATGAAGTGGTAATAGTAAGTGCTATAAGAACACCCATTGGATCCTTTCTAGGCAGCCTTTCCTCCCTGCCAACCACTAAGCTTGGTTCCATTGCAATTCAGGGAGCCATTGAAAAGGCAGGGATTCCAAAAGAAGAAGTGAAAGAAGCATACATGGGTAATGTTCTACAAGGAGGTGAAGGACAGGCGCCTACTAGGCAAGCAGTACTAGGTGCAGGCTTACCAGTATCTATTCCATGTACCACTATAAACAAAGTGTGTGCCTCAGGAATGAAAGCCATTATGATGGCTTCTCAGAATCTTATGTGTGGACATCAGGATGTGATGGTGGCAGGTGGGATGGAGAGCATGTCCAACACTCCCTATGTAATGAACAGAGGAGCAACACCGTATGGTGGGGTAAAGCTTGAAGATTCAATAGTAAAAGATGGGCTAACCGACGTCTACAATAAAATTCATATGGGCAACTGTGCTGAGAATACGGCAAAGAAGCTGAATATTGCACGAGATGAACAGGATACTTATGCTATTAACTCCTACACCAGAAGTAAATCAGCATGGGAAGCTGGAAAATTTGGAAATGAAGTTATTCCTGTCACAATTACAGTAAGAGGCAAACCAGATGTAGTGGTGAAAGAAGATGAAGAATATAAACGTGTTGATTTCACTAAAGTTCCAAAACTGAAGACAGTATTCCAAAAAGAAAACGGTACAGTAACAGCTGCCAATGCCAGCACACTGAATGATGGAGCAGCTGCTATGGTTCTGATGACTGCAGATGCAGCCAAGCGACTCAACGTTAAACCACTGGCAAGAATAGCAGCATTTGCTGATGCTGCTGTAGACCCTATTGATTTTCCAATTGCACCTGCATATGCTGTACCTAAGGTTCTTAAAGATGCAGGATTGAAAAAAGAAGATATTACAATGTGGGAAGTAAATGAAGCCTTTAGTCTCGTTGTACTAGCAAACATTAAAATGCTGGAGATTGATCCTCAAAAAGTGAATATCCATGGAGGAGCTGTTTCTCTGGGACATCCAATTGGGATGTCTGGAGCCAGGATTGTCATTCATTTGGTTCATGCTTTGAAGCAAGGAGAATATGGTCTTGCCAGTATTTGCAATGGAGGAGGAGGTGCTTCTGCCATGCTGATCCAGAAGCTGTAAGACAACAACCTCTGTTGTCTAAGGAGACAATCCTATGTGGCTAGAAAGGCCTGCTGTAATCAGTGTGACTACCTTGGGTCAGCTTGTTCTCAAAATAACATTACGTTTTTAAATTATTTTCTATTTTAACTTTTTTTATAAG