Transcript asmbl_30674

Sequence
Transcript Sequence for observation asmbl_30674 of TGE0004896:
CTTCCGGCCACCTCAGGCCTTTTCCGCTTGTTCTCTGCTGGTTTTAATCTCTCCTTCTCAGGTTGTTTCCGACTGTAGGCCCGGGTCATCTAGCACCCCTTTCCTGCTACCAGCAGTTCGCTGCTCATCCGGTTTCTGTCCGAGGTTTGGAGCAACTCTGCCGTGCAAATTCGCGGAGCGGTCGGGGCTGAGGCCTTCCGCGCACAGTGAGTCCGCGCAGACCTGACCCCGCGTCTACCTACAGCTCCGTGGAGGCCACCGCCGCCTCCGCCTAGGGATGCCGCGGCTGGGGTCCGCGCAGCGCTGGGCGGCCGCTGTGGGCCGTTGGGGCTGCAGGCTGCTCGCGCTGCTGCTGCTGGTGCCGGGACCCAGCAGCGCCTCTGAGATCACTTTCGAGCTGCCTGACAATGCCAAGCAGTGTTTCTACGAGGACATCACGCAAGGCACCAAGTGCACCCTCGAGTTCCAGGTGATTACTGGAGGTCACTATGATGTAGATTGTCGATTAGAAGATCCTGATGGTAATGTGTTATACAAAGAGATGAAGAAACAATATGATAGTTTTACCTTCACAGCTTCTAGAAATGGGACATACAAATTTTGCTTCAGCAATGAATTTTCCACTTTCACACATAAAACCGTATACTTTGATTTTCAAGTTGGAGAAGACCCACCTTTGTTTCCTAGTGAGAACCGAGTCAGTGCTCTTACCCAGATGGAATCTGCCTGTGTTTCAATTCACGAAGCTCTGAAGTCTGTCATCGACTATCAGACTCATTTCCGTTTGAGAGAAGCTCAAGGCCGAAGCCGCGCAGAGGATCTAAACACAAGAGTGGCCTATTGGTCAGTAGGAGAAGCCCTCATCCTTCTGGTGGTTAGCATAGGGCAGGTATTTCTTCTGAAAAGCTTTTTCTCAGATAAAAGAACCACCACAACTCGTGTTGGATCATAACTACGTTTTGAGAATTGATGCACCATTGCAACTATAATATTGCTGTCTTCTAATTAATTAATTTTAGGTACTGAAGAACTTGATATTGGCAACATTTTCAAAACCTTATTCATATACTTGTTAGGGGGTTATGTACAATGCATAAACCCAAACAGTGGAAAGGACACCTTTTTTTATTTGTAAAGGTATAAAAACTTTGGAACTTATTTTGGGCTATTCATGTTAAATATTCAACACCAATGATCTGCTCTTTGTTGTTTATATCTACTCTTTGCACACTAAACTTTGGTATTTTGATTTAGCCATTTAAAAGTACTTTTCTTATAGGTAGTGGATACTTTAAAAACCTTTGATTTAATGTCTACATGTGTTGTGGAGGAAGAAAATTGCCTTTTGATTGTTTATAGTAAATAAGGATTTGTTTTTCAGAAATGCATATGTGATTAACTGCAGTCCACGCCCTATTCTGCACTGTTTAATTTTTATGGGGGAAGAATCTACAATAGAAATGTTTGTTGATATTGATATAATTTTAAATCGATACATCATGGTATAATTTATTTATCACTAGCTTGGAAAATGTCAGATTTTGGCAGGGAGGCAGTTTATTCTATGATTTATAACCAGATATGTTCTTTTTTTCTTAAAGACATTCTTCCACACAAAATAGTGTGTTTCAGTAACATCATAGGGTTTATATGGGCCTTAAAAATCAGATTGTCATGATAAAATAATTAAGAATAATTAAAGTCACTACAATGTCTTATAGTGGAGGGGCAAATGAGAAAATTTTTAGTGAGTTATCTGCACACACTACATTTTCAGTGCTTTTACAAAGAAAAAAGGTGATCTGTTTCATTTTAACATTTTATTGGCTGGTTCTTGCCCTTATGTGGCTTTAATGTCTGAGTCATTCCCAACTTAAAATGACAGTTGTAATATTAGTATCGTAAAAGTGCCATACATTTTATCCTGATTGGTGTGATACACTGAAAAATTAGTTTTTCCCTCCTTCCTTCCCTCCTTCCTTCCTTCTTTCTTTCTGTCTTTCTTTCTGTCTCTCTGTCTCTTTGTCTTGTACATGTAATTTGTACAGTCTCTGCTTAGCAGTCCTATAATTTAAAAATTTAGAATGCTATATGTGTTTTTTATTTGATAATCTTCATTGACTGTACTGCATTTAATGAATATTAAATAGTGCATATTCTGTACACTATAGGGTTTAGACTGTGTTTGTATTTTATAATTTGCGTAGATTAAGCTGATTGAAATAAGATTTTATTCCAGGTATTCTAGAGTAGAATACGAGGTGATGCAAATTGTATAGGTGGTTAAAGCTTTTCTGCCCTTTTAAAAAAAAATTTGCAACTGCTTTTTGCCGTGCCTATCTCCTTCACCCAGAAGTGATAAGTGCTGAACAAGACTCATTGTAGAGACTTTCTTATGTGGTACCATAAAATACTGATGGGATACTAATTCTAGTCACTTAGCACTACTGACTAGAAATAGAAGTTAACTCAACTCTAAGCTGTGTTAAAATGCATATATTTTCTACTGCATGAAAGCGAAAGGAATTCAAGTTGTCATGCTGGCTAGTTTCAAATGCTACAGTGTAGCAAGGGATAAACATGTTTTTAACCCTTAAATTCTAAAATTTTTGAAGACCAAATAGCTAATCCTTAAACTATATCAAGAATTAAGAACTGAAGTTTAAGATTGCAGATTTATCTATGTGGATTCTTATTTTGGAGTTGTCCTGCAGCTTTATAAGTGTCCCTCTATTTTAGATTTGAAATTTTTCAACACTAATGTTGATGTGATTCATAAGCGTGGGTGTGTATTAAATGTCCTTTTTGGTTACCTGTCTGCTCTATTGTATTCAGATTCTTAGACCATAATTAAGCAGAGTCAGGTATCAGTGTGCCGAGTTTGGCATAGATAATGCAGTTATTTCATCTTTGCCTATCAAAACTTCATAATATTAGACTATTACTACAAATAACTTTTGATGAAACTATTGATACTAAAATGTTCGAAATATCTGCTGTTCCTATTGTAGAAAATAGTACAGGCTTAGTCTAGTTTGTATGTAATTGGTTAATGTTTGATGGATGGCTGTCTATACTCAACTGGGTATGTATATATAATTTAGAAAATACGTATCTGTCCAGACATAAGTGTTAAGTAAACTTTTTTCTTCCTCTTCTATATAATTTGTAGCTCATTTTTTTTCTTTAATCCTTTCATAACTTGCTACAGCAGTTTGAATTTCCTGAATGTTTATGTTTCAACAGATGGCTCAGAATACATATTTAAACACCATTAGATGTATATATTTTTAAAGTAGAATAAATAATGGAAAGGGACTTGATATACAAGTTTATACTAAAATTTCAACTGTGTGAAGATACATTAGAAGATATTACTTTGCTAATACTCTAAACATTCTTTTTTCTATTAAAAGAAACGGTTTATGGTTCATAACTTTAATTCTGGCTTCATGATAATCAGCTTTGAAAATACAATGGACCGAAGAGCAATTTTATTCTTTGGAAGATTTCATTTAAATCTCTGTACTATCCATTTTTTCTTCAGTTTGTAAATGTGTAATATTGATCATTAACTAGGACAAAGCAGACCCTATGACTATTGTTTTCAAGAATTAAATTAATATATAAATAATTCAAAGAGGTCTTTCATTTACTTTTGAAGAGAAAACTTGCTCTGAACTGATATTGGTTCTGTAGGTTTGCACCAATCCTTGTAGAATAAAAATATCTTTCAACAAACTGACTTGTTTCTATTAGGATTTAAGCCCTTTTAAAGATCCGTATCAGCTTGCAGCTTGGAAGTACAGTTCTGTAGCGAGAGTGCTTATTTATTTGCTATTTCATTGAAGCATCTTAGGAGCTGGCCAAGAAAGATAAAGAGAAATACAGGTATTCCCCACTTTTCGAAAGTTCACATTATGCCACTTCGCTTTTGCAAAACATCTACATTAGATGTACCTGTCTTCACTAACTGAAGGAAGTCTGAAAAGGACGTCTTAATGAGAAAACGTGAAAAGTGAAAATAGCATTCAGCATTTGTTTTGCAGTGAGCCATTACAGTCAGCAACCACCTAGAGCAGCAAGAGTGGCATTGCTTTTACTATATATTAGTGCTATTTTAGGTTTTATGTGTTATTTGGTAGCTTATTTGGG