Transcript asmbl_30593

Sequence
Transcript Sequence for observation asmbl_30593 of TGE0004893:
GTCGGATCAGGCGCTGCGTGGACAGCCGCACGGGTCCTTGGCTGGGCGGGGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGTGCTCCTTCCCTCTTTTGCTTAGGCCGGTGGTGTTGGCAGGATGGGCAAGTGTCGCGGTCTTCGTACTGCAAGGAAGCTCCGAAGCCATCGGCGAGATCAGAAGTGGCATGATAAACAGTACAAGAAAGCCCATTTGGGCACAGCCCTGAAAGCCAACCCTTTTGGAGGCGCATCCCATGCCAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAAGCCAAACAACCAAATTCTGCCATCAGGAAGTGTGTCAGAGTCCAGCTCATCAAGAATGGCAAAAAGATCACAGCCTTTGTACCCAATGATGGTTGTTTGAATTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGACATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTGTCTCTCTTGGCTTTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAGTTTCAATGGTGAAAACACAGTAATAATAAATTTTCATATGCCAAAAA