Transcript asmbl_2957

Sequence
Transcript Sequence for observation asmbl_2957 of TGE0021503:
GGAGGCTCAGGCTGCGTGAGGTCTTGCTATTTGGGGAGCTACAAAGAAAAAACAAATTAAAGGAAGGTTGGTCTTTTAAGTGGACATGGCTCAGATATCCAGCAACAATGGATTTAAGCAATGTTCGTCTTCACATCTGGAACCACCAAGACCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCAAAACTGCAAAAAGACAGGCGAGTGACTGATAATCAGAGAGGCTTCGAGTTGTCAGGCAGCACCAGACAAAAAGCACAAGTTTATAACAAACAAGATTATGATCTCATGGTGTTTCCTGAATCAGATACCCAAAAAAGAGCAGTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTGGAGAAACTATTGCTAGATGACAGTTTTGAGACAAGGAAAACACCTGTATTGCCAGTTACTCCTGCCCTGAGCCCTTCGTTTTCAGCACAGCTTTATCTTAGACCTACTACTCTTCAGAGGGGACAGTGGCCAACTGGTTTATCTGGGCCTTCAGCTTATACTTTACCTTCTATTTATCAGTCAACTTACAGCAGTAAACAGACTACATTCCAAAATGGCTTTAATCCAAGAATGCCTACTTTTCCATCCACAGAACCGATATATTTAAGTCTTCCAGGACAGTCTCCATATTTTTCATATCCTTTGTCACCTACTACATCTTTTCATCCACAAGGAAGCTTACCTGTCTATCATCCAGTAGTCAGTCCTGACATGGCAAAGCTGTTTGACAAAATAGCTAGTACATCAGAGTTTTTAAAAAATGGAAAAGCAAGGACTGATTTAGAGATAAATTCAAAAACTACAATCAGCAGCCTACAGGTATCTCCAAAGTCTGAAGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAGGTGGACAATGTGGAGGTATTAGACCATGAAGAAGAGAAAAATGTTCCAGGTTTGCTAGCAGAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCATCAGCAAGTTGTCACCTTGAAAGGAAGGTGAATGGAAAATCTCTTTCTGGGGCAGTGGTAACAAGAAGCCAGTCTTTAACTATTCGAACAACTCAGCTTACAAAAGTCCAGGGCCAAATATCTCAGAAAGACCCAAATGGGACCAGTAGTTTGCCAACTGGAAGTTCTCTTCCACAGGAATTTGAAGTACGGAATGAAGAAGTGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAACTTTCCATACACCAATCACTGCACAAATCCAGGCTATTTATTAAGTCCAGTCACAGTGCAAAGAAACATATGTGGAGAAAATGCTAGCGTGAAGGTCTCCATTGAAATTGAAGGATTTCAACTACCAGTTACTTTTACATGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTGCATGATGACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTGAAAGTTTGTGGTCAAGAGGAAGTGCTACAGAATAATCATTGCCTTGGAAGTCATGAACATATTCAAAACTGTCGAAAATGGGACACAGAGATTAAACTACGACTTTTGACCTTCAGCACAATGTGCCAAAATCTGGCCCGAACTGCAGAAGATGATGAAACACCTGTGGATTTAAACAAACACCTGCATCAAATAGAAAAACCATATAAAGAAGTCATGACAAGACACCCTGTTGAAGAACTTTTAGATTCTTATCATAATCAAGTGGAGCTGGCTCTTCAAGTAGAAAACCAGCACCGAGCAGTAGATCAAGTAATTAAAGCCGTAAGAAAAATCTGTAGTGCTTTAGACGGTGTAGAGACTCTTGCCATTACAGAATCAGTAAAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAAGTGCCGATGTGACTTCACTGTCTGGAGAAGGAGACACTAGCAAGAGTTCAACTCGGGACTCCATGGAAATTCTGGTAGGAGTCCTGCAGACTGCATCCAAAGTAACAGGAACATCAAGGAAGCGTGGACTACAGCAGAACAGCTCCAGTTTACTGTCTTTGCTGCACATGGAATTTCAAGTAACTGGGTATCAAATTATGAAAAATACTACTTGATATGTTCACTGACTCACAATGGAAAGGATCTTTTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAATGGGATGAACTAATCATTTTTCCCATCCAGATATCACAGTTGCCATTAGAATCTGTTCTTCACATTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAGCAGAGAAAGGGGCCAGAAGCTTTGGGTAAAGTTTCTTTACCTCTTTTTGATTTTAAACGGTTTTTAACATGTGGAACTAAGCTTTTATACCTTTGGACTTCATCACATACAAATCTGATTCCTGGAACAGTTCTCAAAAAAGGATATGTGATGGAAAGAATAGTGTTACAGGTTGATTTTCCTTCTCCTACATTTGATATCATTTATACCACTCCTCAAGTTGACAGAAGCATTATACAGCAGCACAACTTAGAAACATTGGAAAATGATATAAAAGGGAAACTTCTTGATATTCTTCACAAAGATTCATCGTTTGGACTTTCTAAAGAAGACAAAACCTTTTTGTGGGAGAAACGTTATTATTGCCTGAAACACCCAAATTGTCTTCCTAAAGTACTAGCAAGTGCCCCAAATTGGAAATGGGTTAATCTTGCCAAAACTTACTCATTGCTTCAGCAGTGGCCTCCATTGCACCCACTGACTGCATTAGAGCTTCTTGATTCAAAATTTGCTGATCAAGAAGTGAGGTCCCAAGCTGTGACCTGGATCGAGCCTATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTGCAGGCTTTGAAGTATGAAATTTATTTGAACAGTTCATTAGTGCGCTTCCTTCTGTCCAGGGCATTGGGAAATATACAGATAGCACACAATTTATATTGGCTCCTCAAGGATGCCCTGCATGATGCACAGTTTGGTGCCCGATATGAACATATCTTGGGTGCTCTCCTCTCAGTAGGAGGAAAAGGACTGAGAGAAGAACTCTTGAAGCAGACAAAACTTGTACAGCTTTTAGGAGTAGTAGCAGAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTCCTCCAAAGGAGTATGGAACGAGTACAGTCTTTTTTTCTAAGAAATAAATGTCGCCTGCCTCTCAATCCAAGTCTTGTGGCAAAAGAATTAAATATTAAGTCATGTTCCTTCTTCAGTTCTAATGCTGTGCCCCTAAAAGTCACAATGGTGAATGCTGATCCAATGGGTGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAAATTATGGACAAGATCTGGCTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTTTCAACTGGCAGAGATCGAGGCATGGTGGAGCTAGTTCCTGCTTCAGATACTCTCAGGAAAATCCAAGTGGAATATGGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTGAGGAAATACAATCCCTCTGAAGAGGAATATGAAAAGGCTTCTGAGAATTTTATCTATTCTTGTGCTGGATGCTGTGTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGCACAGGACACATGTTTCACATTGACTTTGGGAAGTTCTTGGGCCATGCACAGATGTTTGGTAGCTTCAGAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATCAACGGGGGTGAAAAGCCCACCATTCGTTTCCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAGAAAGCAAACAAACCTCTTTCTTAACCTGCTTTCACTGATGATTCCTTCAGGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCCCAAACTACAGATGCAGAAGCTACAATTTTCTTTACTAGGCTGATCGAATCAAGTTTAGGAAACATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTACTGGTCTTCCTTCCAATGATGAACCCATCCTTTCATTTTCACCCAAAACTTACTCCTTTAGACAAGATGGTCGAATAAAGGAAGTCTCTGTTTTCACTTACCATAAGAAATACAACCCAGATAAACATTACATTTATGTAGTCCGAATTTTGAGGGAAGGACAGCTCGAGCCATCATTTGTGTTCCGAACATTTGACGAGTTTCAGGAACTTCACAACAAGCTCAGTATTGTTTTTCCACTTTGGAAGTTACCAGGGTTTCCTAATAGAATGGTTCTAGGAAGAACACACATAAAAGATGTAGCAGCCAAGAGAAAAGTTGAGTTAAACAGTTACTTACAAAGTTTGATGAGTGCTTCAACGGACGTAGCAGAGTGTGATCTTGTTTGTACTTTTTTTCACCCTTTACTTCGTGATGAGAAAGCTGAAGGAATAGCTAGGTCTGCAGATGCAGGTCCCTTCAGTCCTACTCCAGGCCAGATAGGAGGAGCAGTGAAATTATCTGTCTCCTACCGAAATGGTACTCTTTTCATCATGGTGATGCACATCAAAGATCTTGTTACTGAAGATGGGGCTGACCCAAATCCATATGTCAAAACCTACCTACTTCCAGATACCCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACTAGGAATCCAACATTCAATGAAATGCTTGTGTACAGTGGATATAGCAAAGAAACCCTAAGACAGAGAGAACTTCAACTAAGTGTACTCAGCGCGGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGAATAACCCTGCCTTTGAAAGATTTCAATTTGAGCAAAGAGACGGTTAGGTGGTATCAGCTGACTGCAGCAACCTATTTGTAAGCTAGTGAATTTGTGAGCTTTGGAAGCAAGAACAGTTAAAACATGTGTGTGCT