Transcript asmbl_29361

Sequence
Transcript Sequence for observation asmbl_29361 of TGE0002767:
CAGGAGAAGAAACTAAGACCTGGAGTTTGAGTAATTCTTTCAAAGCTACCGAGTTGATAGAGGGACGAGAACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATATAGAGGAGCTGGCCATGAAATACGAGAGGCAATCCAGCATCCCGCAGACGAGAAGTTACAGGAGAAAGCATGGGGCGCGGTCGTTCCGCTCGTAGGCAAATTAAAGAAATTCTATGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTCCTGGGAGCCCTGACAAGTACCCCGTATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTACAGAAGAACGTTGAGTCGCATGAGGATTAATAATGTTCCAGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACCCCAATGCTGAAAACCTTAAGTGATGCCACCACAAAGTTTGTATCAGAGAATAAAAATTTACCAATAGAAAACACCACAGATTGTCTAAGCACCATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTCACAAATGAAGAGACGGTGTCATTCTGCTTGAGGGTTATGGTGGGCGTCATAATACTCTATGACCACGTACACCCCGTGGGAGCGTTTGCCAAAACTTCAAAAATCGACATGAAAGGTTGTATCAAGGTTCTTAAGGACCAGCCTCCTAATAGTGTAGAAGGTCTTCTCAACGCCCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATGACACTTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAGTGACTGAGAATGCACAGTTTTTTAGTGATTGCAATTACTATCTCATTTACTCTTGCTTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTATACTCTGAAGGGATATTGTCCTTTCAAACAGGCCGTCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAGAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCTTTTTTCATGTGCAGCCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAACCTTTTTTTAAATTAGTAAGACTTTTGTTTAAAGTTTTAAGTTTGCATTTTCACTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAACTGTGATGTGTGCGTAGAGTATTACGTATGCATGTTCATGTTTAAAGAATGGCTG