Transcript asmbl_28802

Sequence
Transcript Sequence for observation asmbl_28802 of TGE0004797:
GCTACAGACAAAAGAGTGGAGTGTGGGCACTGCCAGGACCTTTGGAGCGATGGCTTGGGTGGCTGTCAGGGCTGGGCAGGCCTGGGACTCTGGGCCCTTCGGAAGAGTCTGCCTAGTCCCCTTAGTAGTTGCCATTCAAAGAGTGGTGGTGAGTAGGATCACTCTTCTCTGTTCTTGGAATTTAGATGAGCCACCCATCCTGCCATCTCAGAGATCCATAGGTGCTCACTCCTATTTTCTGAGTTTTATTTTTAAGAGAGAGGGGGCACAGCAGTCCTGGAGAGGCCTCTGGTTCTGCTAGGTTTTCCAAGTTCCTGCTGGTAGGAGGTGTCCCCTGACCTTTTGCAGCTGGACTTTGTTTTTTCTCTCAGGAGACGGGAGGCCGATGGGAACCAAAGGGCAGGAGGGTCAAAGCAGACCCTTATCCATTTTGTCCCAGGAACCTTTGTCTAGAAAGTTTCCTGGGCGGGCTTCTGTGCAGCTGTCTCCCTCCCCCTCCTCTCCTCTCCCTAGCAGCTCCAAGGTGGGACCAGGTTGGTCTTCATCGGAGGACTTTGAGGGATTTCTTGGAACTCTCCACTGTCAGACTCTTCACCAGGAGGGACCAGGGAGGGGGTGGAGCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTAT