Transcript asmbl_28795

Sequence
Transcript Sequence for observation asmbl_28795 of TGE0004797:
CTGTCTGTCCAAGTCCAGACAGAGCTGACTCCTTCCTTCAAGCCTTGAAGAGCCCCTCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTAT