Transcript asmbl_28663

Sequence
Transcript Sequence for observation asmbl_28663 of TGE0004785:
GCCGGCGGGAGTGGATCTGCTGCTCTGGCTACGGGAGAGTGACCCTGTGAGCATTGGGTCTTGTCGTGGCGATGGCCTCGTTCGTGACAGAAGTTCTGGCACACACGGGGAGTCTGGAGAAGGAGGATCTGGGCACTCGGATCAGCCATCTGACTCGGCGGGTGGAGGAAATCAAGGGTGAGGTGTGCAGTATGATCAGCAAGAAGTACAGTGAATTCTTGCCTAGCATGCAAAGTGCACAGGACCTTGTTACACAAGTGGACAAGCTATCTGATGACATTGACCAGCTGAAATCCAGGATAGAGAGTGAGGTCCGCCGGGATCTTCATGTATCAACCACTGAATTTACAGACTTGAAACAGCAATTGGAAAGAGACTCGGTAGTCCTCAGTTTGCTTAAACAGCTACAAGAGTTTTCTACTGCTATTGAAGAATATAATTGTGCATTAGCAGAGAAGAAGTATGTCACTGCTGCTCACCGTCTAGAAGAGGCACAGAACTGCTTGAAGTTATTAAAATCCAGAAAATGCTTTGATTTAAAAATGTCGAAATCTCTCAGCATGGAGCTTACGATACAGAAACAGAACATACTGTATCACCTTGGAGAGGAGTGGCAGAAGCTGATTATATGGAAGTTCCCACCATCAAAAGATATGAGCAACTTGGAATCTTGTCTACAAACAGAACTTCATTTATACACTGAACAGTCTCAAAACGAAGAGAAGACCCCTGTGCCACCAACCAGTTCTGTCCTCTTGGCATTTTCTATTCTAGGAGAGCTACATACCAAGCTTAAATCATTTGGTCAGATGCTGCTGAAGTATATTCTTAGGCCTTTGGCAACTTGCCCCTCCCTTTTTGCTGTGATAGAAAGGCAGCCTAACATCATTATTATTCGTTTTGAATCTGTGATGACTGACTTGGAACATCCATCACCATCTGAAGTTTTTGCGAAGATCAGACTGGTGTTGGAAGTGCTGCAGAAACAACTAGATTTCCCTCTTGATGCTGATCTAGAAAATGAAAAAACATCTAAGATCATATTGGCTGAGATGCTTGGTGACACGATCTGGGAAGACTTGTCTGAGTGCCTCATTAAAAACTGTTTGGTTTATTCTATCCCAACAAATAGCAGCAAGTTACAGCAGTATGAGGAGATCATACAATCCACTGAAGAATTTGAAAATGCCTTAAAGGAGATGAGGTTTTTAAAAGGAGATACTACTGATTTGCTGAAATATGCCCGTAACATCAATTCTCATTTTGCTAACAAGAAATGTCAGGATGTGATTGTGGCAGCTAGAAATCTAATGACCTCTGAAATTCACAACACTGTGAAGATTACTCCTGATTCTAAGATAAGTGTACCTGACTTACCCAGCCCTGATGTGGATGACAAGCTACAAGTACAGAAAATGTCCATAACTCAGTACAGTGAAGTGGTGAATTTAGAGCCTGAAAATACATTGGACCAACATTCCTTTTCTTTGCCCACATGTCGTGTCAGTGAATCTGCGAAGAAATTAATGGAACTTGCCTATCAGACTTTACTAGAGGCGACAACCAGCAGTGATCAGTGTGCTGTTCAACTTTTCTACTCAGTAAGGAATATCTTCCATTTATTCCATGATGTCGTACCAACATATCATAAGGAGAACCTTCAAAAACTGCCCCAGTTGGCTGCCATTCACCATAACAACTGTATGTATATTGCTCATCACTTGCTGACCCTGGGACATCAGTTCAGATTTCGTCTTGCTCCCATTCTTTGTGATGGCACTACTACTTTCGTGGATCTTGTACCTGGCTTTAGGAGACTTGGGACAGAGTGTTTTTTGGCCCAAATGCGAGCACAGAAAAGAGAACTTCTGGAAAGATTATCAAGTGCTAGGAACTTTTCAAACATGGATGATGAAGAGAACTATTCTGCAGCAAGTAAAGCAGTCCGTCAGGTACTGCACCAACTAAAGAGACTTGGAATTGTGTGGCAGGATGTCCTGCCCGTGAATATATATTGCAAGGCTATGGGGACTTTACTCAATACTGCAATTTCTGAGATCATTGGCAGAATCACTGCCCTAGAGGACATCTCTACTGAAGATGGTGATAGATTGTATTCCTTATGCAAAACAGTGATGGATGAAGGACCTCAAGTATTTGCACCTCTATCTCAGGAAAGCAAGAACAAGAAATATCAAGAAGAGGTTCCAGTCTATGTGCCAAAATGGATGCCATTTAAAGAATTAATGATGGTGTTACAGGCCAGCCTGCAAGAAATTGGGGATCGGTGGGCAGATGGAAAAGGGCCCTTGGCAGCTGCATTCTCTTCCAGTGAAGTAAAAGCTTTAATTCGTGCCTTGTTCCAGAACACAGAAAGAAGAGCAGCTGCCCTTGCTAAGATTAAATAGCTCCACCTTCCCGAGAAAGCCATGTCTTTACTATGGATTTCTCTCTTGGCATAATTACTCATTTAGAGACTTCTTAGAGTCACCCACTGGTTTTGGTGAACCAATATATCATGGAAGTTTTATTTCACCTAAGAACGCCTTACCTCTTGGCTTGTAGGAGGCCATGTTGAATAACTGGATGTTAAGATGTCAAGTGAAGCACCTTACTTTGTTGAATTTCTAGCCACCCTTCTTAGATAAGAAACTGTAGAGCAGCATTGTTTTATGTTACTTCTAGGGCCTTCTGGGAACCATATCCATTGTAAATGTAGGCCCTGGCCTCGGATCAAGGAATCCAGGAGATTCCAGGAGTCAGGGTAAAGAATTTGTGAGCAAACAGGAGATATATTTTGGGGGGTAGGGGAACCATATTTGGCTTTGCAGAAATTAAGAAGACTTCCTTTAAGATTTTTTCCAATAAATAATGCTTTTAAGA