Transcript asmbl_27510

Sequence
Transcript Sequence for observation asmbl_27510 of TGE0003178:
ACGGAGATTCCGGGGGGGTTTGGAGCAGAGCGGTTTGGTCGTTCGTTGGAGCAACTTCTTTGTTTTGGTTGGTGACTGCGGCTCTTCGTTGGGCAGTGGGAGCGGTGCGGCGGTGGGAGAGGCGGCCTAGGGCTTCAGCGTTAGGTGAAAGAAAATGGCCCGAACCAAGCAGACTGCTCGTAAATCCACGGGTGGGAAAGCGCCCCGCAAACAGCTGGCCACTAAGGCTGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAAAAACCTCATCGCTACAGGCCCGGGACCGTTGCGCTTCGAGAAATCCGTCGTTACCAGAAATCGACCGAGCTTCTGATCCGGAAGCTGCCTTTCCAGAGGTTGGTGAGGGAGATCGCCCAGGATTTCAAAACCGACCTGAGGTTCCAGAGTGCTGCCATCGGCGCTCTTCAGGAGGCTAGTGAAGCGTACCTGGTGGGTTTATTTGAAGATACTAATCTGTGTGCCATCCACGCTAAGAGAGTCACCATCATGCCCAAAGATATCCAGTTGGCTCGCCGGATACGGGGGGAGAGAGCTTAAGTGAAGGCAGTTTTTATGGTGTTTTGTAGTAAATTCTGTAAAATACTTTGGTTTAATTTGTGACTTTTTTTGTAAGAAATTGTTTATAATATGTTGCATTTGTACTTAAGTCATTCCATCTTTCACTCAGGATGAATGCGAAAAGTGACTGTTCACAGACCTCAGTGATGTGAGCACTGTTGCTCAGGAGTGACAAGTTGCTAATATGCAGAAGGGATGGGTGATATTTCTTGCTTCTCATGATGCATGTTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAATCGATAAATGTGTACAGGGTCCTTTTGCAATAAAACTGGTTATGACTTGATCCAAGTGTTTAACAATTGGGGCTGTTAAGTCTGACCATGCATCACTGTGATAGAATGTGGGCTTTTTCAAGGGTGAAGATACAAGTCTTAACCACAGTGTAACTTACAGTTTCCTTAAAAAAAGTAAACCTGGCAGCTATAGAATACACTATGTGCATTTATAATAGCTATTTTATATATTGTAGTGTCAACATTTTTAAATTAAATGTTTTACATTCACATGTGGTGGGGAGTCTTGTCATTAAGGTGTGTGTAATTTTAGAGTCCAGTTGGTTTTCTCCTAACTAGAGTGCACTTGTTTTCATAGTAGTAAAATGCTTTGCGCATCATACCTTGCATAAGTCCTCATTCTACCACATGTTAACTAACTCTAGCTGATAATGCAAACACTAACGGGGAATTTTATTTATAAGGGCTCTAGAATATAATACAAGTTATTCACACCAGCATCATCTGTTACTAATCTGAACTAGTTAGTGCAGCTTTTCTTTGTGTTGTGGTTGGTCTCATAACTAGGTTGAGTTTTTCTCTAAGTAGAGGAAACAATACGGAAATTCTTTTCCTTGTGGAGTTTGTATTATAAGGCTTAGAGTAAACTTGTGGTGGGGGAGGGGCACACAGCTCCAGCTTTTCGAACCTCAGCCAGTTAAGATGGCGTCTAGTGAGGTTACATCTGGTATATGGTTCTGGGGAAATCACTTTAGAGATGGTCTTCCAAGTGGTTTTTAAATTTATCCTTCTATTGAAGTTTTTAGGTCAATTATGTATGTTGACTAAATTTACAAATAAACTTGTTTATCCAACTAAGTGTCAAAAACCTAAATTGAATGTACAAACCCACCCATTATCTAGGTCCTTTGTATCTTAAAGTTTGAGTTTAGCTTTTTTAGGTTTTGCTTGGTAGATGAACCTTTTATTTACAAAAATAGTCATAGAAAGCATGTAAAAGTCCCTCTGCTCTGAAAAATGCCATGATTGCTATTTTTTGCAGTGCGGGCTTAAGACGTATTAATATGCTTCCCTTTGCCCCCATGTTGTCAAGGTATAAAAATTTGTCTATTCAAGGTATAACAGGTCAAGGAAAGTAAATTTCTTTAAAATTCGAGGGCTCAAATTTGGTATCTGTTCCAAGAACCTTTTCTGGCAGTATGTAGATCTCTACGTAGCAAATTATTTTAACAGAAGCGCAGAGGTAGAGAATTCATTGGTCTAAGCCACCTTTTCAGTATAAAAACTAGTTTTCTTGACCAATGATGGGCAGCAGTAAAGCTCAGTATATGTCAGCTGGATGTGGGCACAAGAGCCACCAATCATTAGGAGGTGTTCGGTATATTTAAAGTTAGCTGTAGGAACACATTTTTGCCCTAAAGGCTTTTTTAATAAGTTAGCATTAGTTTCAACTTTAAAGGGTTTGTGAAGAAGCTAGCTAGAGTAGCCTTGGGAGTCCTGGTTAAACAGCCTTAGGGGGGATATCAAAGGCGGAGTCCAATACAATACAAAATACAATGAATGGTTTTGTAAAAGGTCCATTATAACCAGTGCTTGGAACAATGACTGACTGAGAACTTATGTTGTTACTTCCGAAGGAAGTTGAAGTCCTAGACATTGGGATATGCTGTGCTCTGGAGTGTGGCAGTGTTTGAACACAAGTAGAAGCAGCTATGAGTTAGCTTGAGTTTCTACCTGTGGTAACAAGCGGGTAACGCTTGAACTTTACGCAGTCTGTGTCTTGATGTAGAAAGTTCTTGAATTTTATTGGGTGACTTGGAATTTGCTGCTTAAATAGTGTAACACTTCCATACTTTACTTGAGCACACATCACAGAAGGCAAAAATATTTTTTGGTTCTAGGAAGGTACCCACACAGGAGATAATCTGGGTATAGGTGATGGAACAGAGTCTGTAAGGAGAAAAGCAAAAATTGGAGCTGATGAAAGGTATCCTGTGCCCTTGATGGATGAGACAAAAATAAAGTTTTTGAAGTTGCAGACTT