Transcript asmbl_27482

Sequence
Transcript Sequence for observation asmbl_27482 of TGE0008906:
ATTTGACGTAAGCTTTTCCCCGCTTTTTTCTTTCTGTTCTTTGAAATTGTAAGAATGGTTGCTCACTCCCTCTCTTGTTCCGTTTGATGTCACAGTTGGAAAGACTTCAAATTATGCGATAGTGCTTGCCCAGCTCTACACTAAGGGGAAGTGCTATGGATTACACGCCTTCATTGTACCCATTCGTGAGATGGGAACCCACAAGCCTTTGCCAGGTATTACCGTTGGTGACATTGGCCCCAAATTTGGCTATGATGAGGTGGATAATGGTTACCTGAAGATGGACAGTTACCGTATTCCCAGAGAAAACATGCTGATGAAGTACGCCCAGGTGAAGCCCGACGGCACGTACGTGAAACCCGTGAGTAACAAGCTGACCTACGGGACCATGGTGTTTGTCAGGTCCCTCCTTGTGAAAGATGCCGCTCAGTGCCTATCGAAGGCGTGCACCATTGCCATCCGGTACAGCGCCGTGAGGCACCAGTCTGAAATCGAGCCAGGTGAACCAGAACCACAGATTTTGGATTTTCAGACCCAACAATATAAACTCTTTCCACTCCTGGCCACTGCCTATGCCTTCCATTTTGTGGGCGCATACATTAAGGAGACCTATCATCGGGTTAATGAGGACATTGGCCAAGGGGACCTGAGTGAGTTGCCCGAGCTTCACGCGCTCACTGCCGGGCTGAAGGCGTACACCACCTGGACGGCGAGCAGTGCTATTGAAGCTTGTCGGATGGCTTGTGGCGGCCACGGCTTTTCTCACTGCAGCGGTCTCCCCAGTATTTACGTCACTTTTACCCCAACCTGCACCTTCGAGGGAGAAAACACTGTCATGATGCTGCAGACGGCTAGGTTCCTGATGAAAAGCTATGACCAGGTGCGCTCAGGAAAGCTGCTGTGCGGCCTGGTGTCCTACTTGAACGACCTACCCAGTCAGCGCATCCAGCCACAGCAGGTGGCGGTCTGGCCGGCTGTGCTGGATATCAGCAGCCCCGACAGCCTGACGGAAGCGTATAAACTCCGAGCAGCCAGATTAGTAGAAATTGCTGCGAAAACCCTTCAAGCTGAACTGAGTCACAGAAAAAGTAAGGAGGTCGCTTGGAACCTCAGTTCCATCGACCTTGTTCGAGCAAGTGAGGCACATTGCCACTATGTGACAGTTAAGCTCTTTTCAGAAAAACTCCCCAAAATTCAAGATAAATCCATCCAAGCTGTCTTGAGGAATTTATGTCTCTTATATTCTCTGTACGGAATCAGTCAGAAGGCAGGGGATTTTCTTCAGGAGAGCATTCTGACAGACTCTCAAATTGCCCAAGTACACCAGCGTATCAAGGAGTTACTGACCGTCATTCGCCCAGATGCTGTTGCTTTGGTTGATGCGTTTGATTTTCAGGATATGTCACTGGGCTCTGTACTTGGCCGCTATGATGGGAATGTGTATGAGAACTTGTTTGAGTGGGCCAAGAAATCCCCACTAAACAAAGAAGAGGTCCATAAATCTTTCTACAAGTACCTGAAGCCTTTGCAGTCCAAACTCTGAATGTCACGACGAGTTTATTCTGCCCCAGGAAGCAGCTGTACTCTGCTGCTCCCCTGGTACCTGCCACACAAATCTACGCGGAATCTTTATCGAATTCGGAGAGCTATAGAGCAAATGATAAATTGGCCCCTTTCCCATCTATAAATAAAAAAATGAACAGCTTACAGAAATTAAATGAAAAAAACATGTTTTTAAGTGCAATTAACACTGAAAGAGACCCGTTAAGCATTCAGAAAAAGCTTTGAGAAATGTACTCTGACTTCCATATGTACAGCTGCTGATCCCAGGAGGCCATAACTTACGATAATTAGTAAAACTTAACTACTGAGTAGTTAATTATTTTCACATCTTAATTGCACATCACTGGATATATGTGTTTTTAAGCAAAGGTATTTTTAAAAGGGTACAACCCTTCCAAGTTTTCCTGCTTAGTGTCCCTGTCACTACTGTCATGGGCCTTGGCTTAAAAGCAGGACCCGAGGCTGGATTGGGGGAAAGAAACCAATCAGAAACTTTAGTGTGAGTTTGTGCTTAACTCATCTTCTGCCTGCTTGCCCTTGGTTGCTGACATAATGTTTCTGTTTGTTCATAGTAGCATTTTTCCTACACAGGGATTTCTTCAGCACAGAGCTACTACAGGGTCATTGTCCTATGTGACTGGGAATCGATCTTCCACTCGAAGGATCCTAAAATTGTCACTGTAGTAGCACTGCAACTCCCTGTGTCCCCAACTTCTAGTGGAGGGGTAGGTAGCAAAGTTATCTCTACATAGGACTTTTGGCAGCTAATGGGACTCAGTCAGTGGTGTTTGATCTCCCTCCATCCCTGTCCCTTAACCTCTCCTGAAAGAGATGCCGGAGGAGAAGAGAGTCACAGTTCCCTCCTAGTAGAATATGTATAGGGAAAGCTCTCGGTTACGGTTACGGTAACTTTGGGTACCATAGTAACTGGTAGATTTCATATATTCTGTTATATTGGCATAAACCATTAAAATGCTTGGAAGTTACAGTACCTTGCATTAGGAAAGTAAAATCATATTTCAGGTTAACTCTTAGACCCAGGGGTAGCACAGAAAAATCTTTTGACAAACCATGTGTTCTGATTTTTGGATCAGAAAATATAATCTTTGAAGGATAAAGGATAAATGGGACTTCCATAGGATCTCTTTCTTTTTTTCGTTTAGGTGAGGCAACACCCTTGGTGGACCTCACAGATTGCAAGGAACTTGTCAGCTTACAATCCCTTATT