Transcript asmbl_14373

Sequence
Transcript Sequence for observation asmbl_14373 of TGE0000287:
GTTAGCCCGCCCGCTCGGCGCAGGGCGTGGCTTCTCGTAGCCATTAGGAAACAGCAACCCTTTCACCTCAGTTTTCTTCACTCCGGCATTTGCAGCAGAGCGAAAGGTGGTCGAGTCCTGAAGGAGGGCCTGATGTCTTCATCATTCTCAAATTCTTAGGACGGTCGGGCCCTGGAAGGAACGCTCTCGGAATTGGCCGCGGAAACCGATCTGCCCGTTGTGTTTGTGAAACAGAGAAAGATAGGCGGCCATGGTCCAACCTTGAAGGCTTATCAGGAGGGCAGACTTCAAAAGCTACTAAAAATGAACGGCCCTGAAGATCTTCCCAAGTCCTATGACTATGACCTTATCATCATTGGAGGTGGCTCAGGAGGTCTGGCAGCTGCTAAGGAGGCAGCCCAATATGGCAAGAAGGTGATGGTCCTGGACTTTGTCACTCCCACCCCTCTTGGAACTAGATGGGGTCTCGGAGGAACATGTGTGAATGTGGGTTGCATACCTAAAAAACTGATGCATCAAGCAGCTTTGTTAGGACAAGCCCTGCAAGACTCTCGAAATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAATCACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCTTATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCAGCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATACTGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCCTATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCCATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCATCAAGTTTATAAGACAGTTCGTACCAATTAAAGTTGAACAAATTGAAGCAGGGACACCAGGCCGACTCAGAGTAGTAGCTCAGTCCACCAATAGTGAGGAAATCATTGAAGGAGAATATAATACGGTGATGCTGGCAATAGGAAGAGATGCTTGCACAAGAAAAATTGGCTTAGAAACCGTAGGGGTGAAGATAAATGAAAAGACTGGAAAAATACCTGTCACAGATGAAGAACAGACCAATGTGCCTTACATCTATGCCATTGGCGATATATTGGAGGATAAGGTGGAGCTCACCCCAGTTGCAATCCAGGCAGGAAGATTGCTGGCTCAGAGGCTCTATGCAGGTTCCACTGTCAAGTGTGACTATGAAAATGTTCCAACCACTGTATTTACTCCTTTGGAATATGGTGCTTGTGGCCTTTCTGAGGAGAAAGCTGTGGAGAAGTTTGGGGAAGAAAATATTGAGGTTTACCATAGTTACTTTTGGCCATTGGAATGGACGATTCCGTCAAGAGATAACAACAAATGTTATGCAAAAATAATCTGTAATACTAAAGACAATGAACGTGTTGTGGGCTTTCACGTACTGGGTCCAAATGCTGGAGAAGTTACACAAGGCTTTGCAGCTGCGCTCAAATGTGGACTGACCAAAAAGCAGCTGGACAGCACAATTGGAATCCACCCTGTCTGTGCAGAGGTATTCACAACATTGTCTGTGACCAAGCGCTCTGGGGCAAGCATCCTCCAGGCTGGCTGCTGAGGTTAAGCCCCAGTGTGGATGCTGTTGCCAAGACTGCAAACCACTGGCTCGTTTCCGTGCCCAAATCCAAGGCGAAGTTTTCTAGAGGGTTCTTGGGCTCTTGGCACCTGCGTGTCCTGTGCTTACCACCGCCCAAGGCCCCCTTGGATCTCTTGGATAGGAGTTGGTGAATAGAAGGCAGGCAGCATCACACTGGGGTCACTGACAGACTTGAAGCTGACATTTGGCAGGGCATCGAAGGGATGCATCCATGAAGTCACCAGTCTCAAGCCCATGTGGTAGGCGGTGATGGAACAACTGTCAAATCAGTTTTAGCATGACCTTTCCTTGTGGATTTTCTTATTCTCGTTGTCAAGTTTTCTAGGGTTGAATTTTTTTCTTTTTTCTCCATGGTGTTAATGATATTAGAGATGAAAAACGTTAGCAGTTGATTTTTGTCCAAAAGCAAGTCATGGCTAGAGTATCCATGCAAGGTGTCTTGTTGCATGGAAGGGATAGTTTGGCTCCCTTGGAGGCTATGTAGGCTTGTCCCGGGAAAGAGAACTGTCCTGCAGCTGAAATGGACTGTTCTTTACTGACCTGCTCAGCAGTTTCTTCTCTCATATATTCCCAAAACAAGTACATCTGCGATCAACTCTAGCCAAATTTGCCCCTGTGTGCTACATGATGGATGATTATTATTTTAAGGTCTGTTTAGGAAGGGAAATGGCTACTTGGCCAGCCATTGCCTGGCATTTGGTAGTATAGTATGATTCTCACCATTATTTGTCATGGAGGCAGACATACACCAGAAATGGGGGAGAAACAGTACATATCTTTCTGTCTTTAGTTTATTGTGTGCTGGTCTAAGCAAGCTGAGATCATTTGCAATGGAAAACACGTAACTTGTTTAAAAGTTTTTCTGGTAGCTTTAGCTTTATGCTAAAAAAAATAATGACATTGGGTATCTATTTCTTTCTAAGACTACATTAGTAGGAAAATAAGTCTTTTCATGCTTATGATTTAGCTGTTTTGTGGTAATTGCTTTTTAAAGGAAGTTATTAATATCATAAGTTATTATTAATATTTTGAACACAGGTGGATGTGAAGGATTTTCATTTAAAAACCAAGTGGTTTTGACTTTTTCTGTTGAATGAACAACTGTGCCTTGTGGAATTTTTGCAGAAGTGTTTATGCTTTGTTAGCATTTCAACTTGCATTATTATAAAGAGGTATTAATGCCTCAGTTATGTGTTTGTCAATGTACTGGCTGAGGATTCTATCTCAGCTGTCTTTTCTAACTGTGTAGGTTGAGTTTTGAACACGTGCTTGTGGACATCAGGCCTCCTGCCAGCAGTTCTTGAAGCTTCTTTTTCATTCCTGCTACTCTACCTGTATTTCTCAGTTGCAGCACTGAGTGGTCAAAATACATTTCTGGGCCACCTCAGGGAACCCATGCATCTGCCTGGCATTTAGGCAGCAGAGCCCCTGACCGTCCCCCACAGGGCTCTGCCTCACGTCCTCATCTCATTTGGCTGTGTAAAGAAATGGGAAAAGGGAAAAGGAGAGAGCAATTGAGGCAGTTGACCATATTCAGTTTTATTTATTTATTTTTAATTTGTTTTTTTCTCCAAGTCCACCAGTCTCTGAAATTAGAACAGTAGGCGGTATGAGATAATCAGGCCTAATCATGTTGTGATTCTCTTTTCTTAGTGGAGTGGAATGTTCTATCCCCACAAGAAGGATTATATCTTATAGACTTGTCTTGTTCAGATTCTGTATTTACCCATTTTATTGAAACATATACTAAGTTCCATGTATTTTTGTTACAAATCTTCTGAAAAAAAACAAAACAATGTGAAACATTAAAATTAAAAGGCATTAATAATAT