Transcript asmbl_27382

Sequence
Transcript Sequence for observation asmbl_27382 of TGE0004664:
GGCAGGCCTCCTTTGTGGCCGCGCCAGTGGCCCTCGGGCCCACCTTCCCAGCCGGTGCGCGCGGGAAGGGACCAGGCCTGACGCCCTTACCCCGAAGAAGGCGCGCCCGTCTTCTGGACATCCCCGAGCTCCCCACCCCACTTAACCCCACCCCGCGCCTGGCCCAGATTGCGGGGCCCAGCGAAAGTACGGGCGGCGGCATCGCTCTCGGAGGATCCTGTCGCCTGCGGCCGCACTGGGTGGCGTTAGGGCGTGAGCCTTCTACAGGAATTCCAGAGGAAGCGGCTGGGAGGCCTGGAAGAGCCGGCGGCCCCACCCTGCCTGCGGCGGCCGGCCCGCTCTAGGTGCCCAGTGGCCCTTTGTGAGACCTGGTACTTGGGCACGTCCTGGCTGCCAGGCTGGATCCGGAGAAAAGGCGTTGTTTACCTTCCCGTGGCCACCTGAGTTCCGGGGTCAGCTGGGCCCCGACCCACCTTCCATAGGCGTGGGCGGACCCGAGCGGGCTTCATCGACCCCATCCGAGGTCCTGGGGCGTGTGATAGGGAACCATAGCCTCAGTCGTGCCGCTCCTGCTGGACAGCGCTGCTGCAGACTCTTCTGGACCAGGGTCCGGAAGGAGGGTCCTGAGAGCACCAAGAGGCTGCAGCAGGTCCTAGCTCTAGGTCACACACCGTCACAACAGGAAGGAACGTGGGCGGACAGGATTCCCGTGCCCTTGTGAGAAACCTGTGGGACTCAGGCTGGCCCCTTTATCTGAGTTCCAGGAGAGCCTCGCATTTGCACGGCGAGGCAGAACTGACTTGTGTCGTGCATGGAGGCCTTGCTTCCCCGCTGGATCGAGGTCCGAGGCGTCCACGGTTGGGGAGCAGCTCCCTGAGCCAGCAGCAGGGACCCCTGGGGCTGGGGACCTGGGTGACTCAGGACAAGCAGCAGAACTCGAGGCGACTCTGAGCTGGGGTTGCTGCGTCTCTCTGGGGGCAGGCTGCAGGTCCCATGGGTCCTCAGACTGTCTCAGCAGGTCCCCAGAGGTAGGCAGGGCAGAGGTCAGTGTGGCCCCGCTGGGCTTCAGGAGCCTGCATCCGGGCCCTTTACAGATGCCTGGCTGCAGCCGCCCACCTGCTCTGGAAGGCGCGTTCCCCCTCGGGTGCAGACGCGGGGCCTGACCACCTGCAGAGGCCTCGTGGGAAGGGGAGACACCGGCCCCCTCCAGGTCACCATAGTCTGTCCCACCCACAGGTGTGGCAGATCCAGCTAGAGGCAGCATGGCCGAGCAGGAGCCCACCGCCGAGCAGTTGGCGCAGATTGCGGCGGACAACGAGGAGGACGAGCACTCGGTGGGCTACCGGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAGAGTCTGCGCAAGTACAAAGAGGCCCTGCTGGGCCGTGTGGCTGTGGCCGCTGACCCCAATGTCCCCAACGTTGTTGTGACCCGCCTGACCCTGGTGTGCAGCACAGCCCCGGGCCCCCTGGAGCTGGACCTGTCTGGGGACCTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAAGAGGGTGTGGAGTATCGGATAAAGATCTCTTTCCGGGTGAACCGAGAGATCGTGTCCGGCATGAAGTACATCCAGCACACGTTCCGGAAAGGCGTCAGGATCGACAAGACCGACTACATGGTGGGGAGCTACGGGCCGCGCGCCGAGGAGTACGAGTTCCTGACGCCCGTGGAGGAGGCGCCGAAGGGCATGCTGGCCCGCGGGAGCTACAACATCAAGTCCCGCTTCACAGACGACGACAAGACTGATCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGAGTGGAAGGACTGAGCGTAGGCCTGGAGGCAGGCAGGGTGATGGCGGGGCGCACCCCCCACCCCTCCCCCACCCCCATACCAAAGTGCTGACAGGGCGCCTGCCCACGCTGCGGTCTTTCCCCCTGGTCCGCCTCCCGGCCAGCCCGGCCCCCCTCGACCCTCCCCAGCCTGCAGCCCCCAGCCTCCTGGGTGGTCTCGTGTCACTGCTGCTTCATTCTGTGCTGTGAGGGGAGGACGGCCGTAGCCCAGGCCTCCCCCTCCCCCTCTGTGTCCCTCCACGTTCCCCCACCTGTCCTGACCCCGCCTGAGGCCCTGGCTTTTCCGAGGCAGTGGGGCATTGGATGGGGTCTCGTGGTTTCAGTTGCCCCAACTCCCATCGTCTCCCCCTGCGGGGTGGGGGTGGGGTGCATGATGCAGGGCCTTGTGGGGACCAGCCGTCCCCCAGCTGTCACTCTTCCCTGGTCAGCTTGCCCACCGTTGTCAGTAACCATCTAACCATGATGCCTTAACATGCAGAACGTGTGCGTGGGGCCGTCACTAATCTCTGACCCCTGTGTCTGCATGAGCATGTGGTCTCCCCCAGTCCCTTTCCCAGCTGCAGTCCCGGTCGCCCAGGGAGGTGTAGGATGTGCTGCTGCTGTTCCCCGGCCTGCCAGGGCCTGGCCAGCCCCCTCCCCGTGGCCCTCCCCTAGCCCGGGCTGTGGGGACAGTCCCAGGCGCTTAGGGAAAGCCAAATTGCCAAAACTCAAGTCGCCTCCAGTCTCATCGGGGAGGCTGGGTGTCCTCATGCCTCTGCCTTCTTTGTCCCAGTGGGCAGCACCCAGACCCAGACCCCACAGCCCCGACAGACAGCCCTCGGTGGACAAAGCCAGCAGCCGAGCCTTACTTGTCCCACCTGGGCCCACCGGCCTGGAGTGGCATGCCTGGCCTGTCAGTATTTATTGCCTCCATATGTGCCGTCCTCTGGGCCCGCTGGCCTGCCACCTCTGCCCCCAGGCTCGGTGCCACCATCCCTGGCAGGCCCTCCCCGGACCCAGCCAGGACACCCGTGGGACCAAGCATGCACAGTCGGAGCTGTCCCCTGTGCCACCCCTCCCCTCGCTGGTCAGGCCCGGGCTGGAACACAGGAACCCGTCCCTGCTTCTCCTTTTCAGACCAGGAAATAAACTCCCCCCCAGAGGA