Transcript asmbl_27269

Sequence
Transcript Sequence for observation asmbl_27269 of TGE0000808:
GTCTCTGTGGCGGGATGCAGGGAATAGGGGGGTAATCCGAGGTACCGGCGCGCGCCCTCCGCCCTCATAGCCATGCCTCGCAAAATTGAGGAGATCAAGGACTTCCTGCTCACGGCCAGACGAAAAGATGCCAAATCTGTCAAGATCAAGAAAAATAAGGATAATGTGAAGTTTAAAGTTCGGTGCAGCAGATACCTTTACACCTTGGTCATCACAGACAAAGAGAAGGCCGAGAAACTGAAGCAGTCCCTGCCCCCCGGTTTGGCAGTGAAGGAGCTGAAATGAACCAGACATGCTGATCTGAACTGCATTAAAATTTTTAAAAATCTT