Transcript asmbl_27109

Sequence
Transcript Sequence for observation asmbl_27109 of TGE0004615:
CTGCGCGGGTTGCGGACGGTGCTTTGAACCCGGGGCGGGGGCGGCGGCGGGAGCCGAGGTCGGGGTCGGGATTAGTGTCCGCGTCTGGATCCGGCCCGGGCCGCCGGCACTCCTGGGCGTCCGCTTCCGGGCATGGCGGCCGAGGTGCGCGTTTCGCGCTGGTACTTCGGGGGCCTGGCCTCGTGTGGGGCAGCCTGCTGCACGCACCCGCTGGACCTGCTCAAGGTGCACCTGCAGACGCAGCAGGAGGTGAAGCTGCGCATGACCGGCATGGCGCTGCAGGTGGTGCGCTCCGACGGCATCCTGGCGCTCTACAACGGCCTGAGCGCCTCCCTGTGCAGACAGATGACCTACTCCCTGACCCGATTCGCCATCTACGAGACCGTGCGTGACCAGGTGGCCCAGGGCAGCCAGGGGCCCCTGCCCTTCTACAAGAAGGTGTTGCTGGGTTCCCTCAGTGGTTGCATCGGAGGTCTCGTGGGGACTCCCGCTGACATGGTCAACGTCAGGATGCAGAACGACATGAAGCTGCCCCAGGATCAGCGCCGAAACTACGCGCACGCCCTGGACGGCCTGTACCGTGTGGCCCGAGAAGAGGGTCTGAAGAAGCTGTTCTCGGGTGCGACCATGGCGTCTAGTCGAGGGATGTTGGTGACCGTGGGCCAGCTGTCCTGCTATGACCAGGCCAAGCAGCTCGTCCTCAGCATGGGGTACCTGTCTGACGGCATCGTCACTCACTTCATCGCCAGCTTCATCGCAGGTGGGTGTGCCACGTTTCTGTGCCAGCCGCTGGACGTGCTGAAGACCCGTCTGATGAACTCCAAGGGCGAGTATCAGGGCGTTCTCCACTGCACCATGGAGACTGCGAAACTCGGGCCAATGGCCTTTTACAAGGGCCTCTTGCCCGCCGGCATCCGCCTCATGCCCCACACCGTGCTCACGTTCGTGTTTCTGGAACAGCTTCGCAAACACTTTGGCATCAAAGTGCCGTCCTGATGGGGCCGTGGGAGCGAGCTGGGCCGTGCTGGCCCCCAGTGCCAGTTCTTCCACAGTCCCGGCAAGCCAAGCGCTGCCCTAAGCCCAGCACCTGCCCGCAGGGCTCCAGCCCCCCATTCCTGGCCCAGGACGCCCACCCCGTCCTCCCCCACCTGCCTGGGCTGGAGCTCCTTCCAGGAGCTGTCCCCCCAGCACCCCTCCGCTGTAGCTTCGCCTTGGCCCTCCCTACCTGGCACCCCAGTGGCCCCATCCACGCACCTGTGCCTCACTGGGAGGGGCGGGCTCCAAGTGCAGGTTCAGGCTTCTCCCCTCCCCGAGCAGTCAGCCCTGGCGGGGGAGGGGCAGGCTCCAGGCTTTCTGGGGTCCCCCGCCCCTTCGCCTGAGGCGTTTCTTTCACCGAGCAGCTGCCCAGGGCTCACAGCACCGTCTTCCAGCAGCTTCTTTCAAGGACCTGGGAGGCAGAGCGGGGGGAGTGCAGACCCCCAGCATTGCCCACCAAAGCGTGTGCCTGCACGCGCACTTTATCCTAGGAAAGGGACCATAGCTTTCGTGACGTTCTCGAAGGTAGCTGTGCCCCTGCGCTGCTGGGCAGGTGGCGGAGGAGGCAGGGAACGCAGGGTCTGAGCTGTGGGCCCCTCAGGCCCGTCCCGCCCCAGCCAACCCCCTGTTGCTCTAAGGGTTAGTTTCACCAAAAACCTCAGCGCCAGAGGCGCTGCTGTCTGCAGGGAGCGGAGTGTCTCTCACACCGTCCACGCTGTCCCCTCCGGCCCCCGGGGCAGAGGCGGGCTGTGCCGCGTCCTCGGGGCCCCTCTCTCTGTGGACAGCGATCACCCTTCAGGGCCCCCAGCAGCTGACCAGCCAAAACACCGCCGCCCAGGTTCTGCTGCCAGAGCAGCCTGACCCTGCAAATGGGCCTAGGGACTGTGTCTTCACCCCGGTAGGGGGCCGGCCCACAGGGACACTAATAAAGGACAGGAGCTGCTGTGCGTCTAGTCCTTGCATCCAGTCCCTGCG