Transcript asmbl_26356

Sequence
Transcript Sequence for observation asmbl_26356 of TGE0004596:
GGAGGGCGTAGAGCGTTCCCGCCATTGGCGGCGGTTAGGGCGTTTACGCAACGGCCTGACGTAAAGACGCGTTAGTTGGGGGGAAGGTTCTAGAAAAGCGGCAGCAGCGGCTCTAGCGGCAGTAGCAGCAGCGCCGGCTTGCTGTGCGGAGGTTCTCCTAGCGGTGTTGTTTCTCCAGCGGCGGCAGTTCTCACTACAGCGCCAGGACGAGTCCGGTTCGTGTTCGACCGCGGAGATCTCTCTCATCTCGCTCGGCTGCGGGAAATCGGGCTGAAGCGACTGAGTCCGCGATGGAGAAAACTTTAGAAACTGTTCCTTTGGAGAGGAAAAAGAGAGAAAAGGAACAGTTTCGTAAACTCTTTATTGGTGGCTTGAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAGCAATGGGGGAAACTTACAGACTGTGTGGTAATGAGAGATCCTGCAAGCAAAAGATCGAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTCGATGCTGCCATGGCTGCAAGACCTCATTCGATTGATGGGAGAGTGGTTGAGCCAAAACGTGCTGTTGCAAGAGAGGAATCTGGAAAGCCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGTGGGATTAAAGAAGATACTGAGGAACATCATTTTAAAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATTATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGATTTGTTACTTTTGATGACCATGATCCTGTGGATAAGATTGTGTTGCAGAAATACCATACCATCAATGGTCACAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAGATGCAGGAAGTTCAAAGTTCTAGAAGTGGAAGAGGAGGCAACTTCGGTTTTGGAGATTCTCGTGGTGGCGGTGGAAATTTTGGACCAGGACCAGGAAGTAACTTTAGAGGAGGATCTGATGGCTATGGAAGTGGTCGTGGATTTGGGGATGGCTATAATGGGTATGGAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCTGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTATAATGATTTTGGAAATTACAACCAGCAACCTTCTAACTATGGGCCAATGAAGAGTGGAAATTTTGGTGGTAGCAGGAACATGGGAGGACCATATGGTGGAGGAAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGGGGTTATGGAGGGAGAAGCCGATATTAAGCTTCTTCCTATTTGCCATGGGCTTCACTGTATAAATAGGAGAGGATGAGAGCCCAGAGGTAACAGAACAGCTTCAGGTTATCGAAATAACAATGTTAAGGAAACTCTTATCTCAGTCATGCATAAGTATGCAGTGATATGGCAGAAGACACCAGAGCAGATGCAGAGAGCCATTTTGTGAATGGATTGGATTATTTAATAACATTACCTTACTGTGGAGGAAGGATTGTAAAAAATGCCTTTGAGACAGTTTCTTAGCTTTTTAATTGTTGTTTCTTTCTAGTGGTCTTTGTAAGAGTGTAGAAGCATTCCTTCTTTGATAATGTTAAATTTGTAAGTTTCAGGTGACATGTGAAACCTTTTTTAAGATTTTTCTCAAAGTTTTGAAAAGCTATTAGCCAGGATCATGGTGTAATAAGACATAACGTTTTCCTTTAAAAATTTAAGTGCGTGTGTAGAGTTAAGAAGCTGTTGTACATTTATGATTTAATAAAATAATTCTAAAGGAAATTGTGTAATTATAGACTTTTTATTTTAAATAAGTTAAGGAGTGGGTAGTATAATTAAGGTCCATTGCAAAGCTGTTATATTTGTGTAAGATAAATGCTGGTCAGATGTAAGTGTGTTGTCTGCAATTCATCAGGATTAAATTATCTAGATAACTTAAGGGATATCTCTGCAAGGAGAAACACCTTTTTAGATCTTTTAGATGCTGCTTCTTCAATGCAAGGAAAGGAAATAACCCCAGCGAGGTACTCTTCAGGGATACAGGTCTAGTACAAGAAAACTTGACGGCTACTAAGTTCAGCCAGTCTTAAAAAACTGTGCTGTTTCTACAAAGCTTTAACTACAGTAGTTTATAAGGATGCCAACGAAAGCTGAGGGTGTAGAGCAAAATAGTTCTAAGCTTCAGTTAAACTTCTTTAGGTAAGATCTCATTTACTTTTTCTTTCTTAATTTTCCTCCCCAAAAGATAAAACTAATACTCTTCAATGGTCTTCCAGTATAGTGGTTCTTATGTAGTTTAACATAGCTGTAAAATTGAGTTTAACAATTTATAAACTCAAGAGAATAATTTTATACACCCTTGTTTTCCAATCTGTCATTTAAATTATTTTGGTTGTTTTTTCCCTTTTTCCTTCTTTCCCACCCCCTCCCCCTCTATGAAGATTCAGGTGCTTAACATATCATTTTTTTCCCTGCTGGAATTTTAGCATTGATATGAACCGTGGACAAGTATATTCTGCTGCCATAAAGACTGTAAAGTGCTTCATTTCAACAGCTGAGGCAAGCCAAGTGATCATTAATAAAGCTTTTCTTGGTTCCTTCAGTGGTGTTGGTAGTAAAATGGAAGGTGTCTTGCTGCAGGTAACTAATGAAGAAGTGGTCAACCACAGAGTCTTCAAGAAATAAGAAATTCTGTACCATCTGAAAATAGTTCTTGGTGCCTTCATTTAAAAAGCACTCTTTAAGATTAAAGGGAAACGTTTTCTGATAAAAAAAAAAGTCATTTAGTACAGGTTCTTGATATAAAACAATTACAAGTATTGTTTGTGAAAGTTACATCATCAGATAAATGTATCATGTTTTAAATTAGGTTTTGTGAGTAGACAGATCAAAATTCTATTTTAAATACTAAGTTTATAAAATAAATACTTTTGTATCCAAATACTTGGTGTAATGTTTACACATAAAATGTGTGAATCTTGTACTACAAACATTCAGTTGTCTAAAGGATTGCCATCCCCTAGATATATAAAGCAGTTTCACAAAGCTGTGCATATTGCCATTTTCCAATTTTGAGAGATGAGAAAAGCATTGTGGACATTATTGGCAGTCCCTAATAAAAAATGCCATTCTTTATACACTGTATATTCAGCGTTTGAATACTGCTATAGTTTTCTGGCTTTAC