Transcript asmbl_26348

Sequence
Transcript Sequence for observation asmbl_26348 of TGE0004593:
AGGTAATTCGGAGCTCTCAAAATGTTTGCCAAAGCAACAAAGAATTTTCTTAGAGAAGTTGATTCTGGAGGTGATCTGATTGCAGTATCGAACTTGAATGACTCTGATAAGTTACAACTTCTAAGCCTAGTGACCAAAAAAAAGAGATTCTGGTGCTGGCAGAGACCAAAGTATAACTTTTTATCTGTCACCCTTGGAGATGTGCTCATAGAAGACCAATTTCTGAGTCCAGTGGTCGTGGAGTCGGACTTTGTGAAATACGAGGGAAAGTTTAAAAACCACGTGAGTGGAACCATCGAGACGACACTGGGGAAGGTCAAGTTGAATATTGGAGGCAAAGGCCTTATGGAGAGTCAGTCTTCATTTGGAACCCTGAGGAAACAGGAAGTGGACTTGCAGCAGCTCCTCAGGGATGCCGTGGAGAGAACGATAAATCTGAAAAACCCTGTGCTGCAGCAGGTGCTGGAGAGGAAGAATGAGGTCCTGTGTGTCCTGATACAGAAGATAGCGACAACGCAGAAGTGCGTGATCTCTGAGCGCATCCAGGTTGAGGAGAAGTGCGGTGGCATCGTGGGGATCCAAACCAAGACGGTGCAGGTGCAGGCCTCCCGGGGCGGAGGTGCAGGCCTCTCGGGGCCAGAGGTGTCTGCTGCGGAGGATAGGGCTGTCACCAAGGACACCAACGTGGTGTTGGAGATCCCAGCTTCCACCACCATTGCCTACAGTGTCATCGAGTTGTATGTGAAAGTGAATGGCCAGTTCGAATTCTGCCTCCTACAAGGAAAGCATGGTGGCTTTGAGCAAGAGAGAAGAAGCAACTCTGTCTCCCCGAGCTCCCTGCCCTTTCAAGAGTTTGCGTTTAGCGACATGCCAGATGCCTGGCAGGGGCCGCCTGCCTCGGATAAGCCACTGAGTGTTTTAAAAGAAGTGACTCTGCCCTTGGAGAAGAGTTTCCGTCCCTTCGCAGAGCTGCCCGAGCAGCAGCAGACGGCCTTGAGCGGCATCCTGCAGGCGGTCCTGTTTGATGACGAGTTACTCCTGGCCTTGGAGCAAGTGTGTGACGATGTGTTCAGCGATCTGTCACCCCCACGGGTGATACCTGGAGAGCTGAAGCCCTCACAGCAGCAGGACCTCATGGCCTTCCTGCACCTGGTGGGGTACAGCATGCAGAGTGGGTGTCCGGGCCCGGAGGATGCTGTCAGCAACCAGAAGCTCTTCTCTACGGCCTACTTCTTGGTCAGTGCACTAGCAGAAATGCCAGATAATGCAGCAGCTCTTCTGGGCACGTGCTGTAAACTCCAGATTATTCCTACGCTGTGTCACCTGCTCCACGTGCTGTCTGCTGATGGAGAATCTGATCTTGAAGACGCAGCCCTGGCTCCTCTGAGAGATACAGAGAGGTTTGAGATTGTGCAGCGCCTGCTTGCTGCAGCTGACATTAACCTGGAGCGACAGCAGTCGTCCGTGAAAGCTGTCACCTGCCAAGTTCCTAACGTTTCCCCGCTCGTTCTTTATATAAGCCTGAATGGACTCTGGGCTTTAGGCAGAATGCATCAGTAACGTCACACGTGAATCATGAGGACATGTTCTCGGCCAAGGCTGGGTAACTTTCAGGATCGTTGAGATACTACTTTGGGGCCTAGGTCAGATCTATGTTGAAAGATGCTCAAGGAAATGAATTTACAAGAGTCTATGGAGTGGTAACTTTTTACGCTAGGAATCGCCTTGAGTTTAGCCACCAGGTACTCTGTTTCTGTTTCATACGAGGCCCTCCTGTGCTGGTCACCCCATGTGCAAGTTCAACTCCAGCACCCGAAGGCCTGGGGAAGGGATGAGAATTCTAAGCCAGAGTACATTCAGACCTTTTTTTTCTGGAGCGGCACTGAAAAAAATGGGTCCATCTATCACTTACATTTCCCTCTTTCTTCCTGTTGTACCAAAACAAATGGGTCTGCCACTTTGATCCAAAAATTCACTTTAAATTGTGAACGTTGTGGAAGGGCAATTTCTCTTCATAGAAGGCTACGTTTTGGACGTGCTATATGCCTTGCAGTGACTGAAAAATGAACTGTAAGTGCCACTAGAGCACATATATTCTTCTGCTAAACAAAATTATACTAGAAAAATCTAATAGCAGGGCACCTTTCCTTAAGGGTCTAGCTATATGCATTTTATTTGGCTTTGATGAACATAATAATTCTCTGTCAAGAACAATGTGCTAGTATCCCATACAATCTTGATGTTTAATTTGTAAAATACTACATCCCGTATCCAAGGAAACTCTGAACTGTGTGTATGTCGCTTTTTATTGTTTCCATATCCTTCTATAAATAGCCTGGACTGTCCCCTTGCTACTGGGGACCTGAAGCCAGCACCCTGCTTTCTGCCTTAGCAGAAAGTAGCTATCCCTCCTGCTAGAACCTGTCTGTCTTCAGGAGCATGGGGGTGAGGAGCCGCAGTTGTTGGGGAGAAACATTTCACTCGGTATTTTTTTTTTACCTCAATATCATCTACTTATTCCTTTCCTGCCCTTAAGATTCGAATTAACATTAATGGGGAAGAAATGGAGCAAATAACCATTTCATCACCTCTAGTAAAAATGAGACTAA