Transcript asmbl_26183

Sequence
Transcript Sequence for observation asmbl_26183 of TGE0004565:
CCGCCGCTGCTGCTGCTGCTGCTGTCGCTGCCGGAATCGCCGCAGCTCCCAGCCTCGCGCGTCGCCGCTACCTTCTCGGACAGAAATTTTATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGATGAAAAAGAGAAATTCGAACCTACAGTCTTCAGGGATACACTTGTCCAGGGGCTTAATGAAGCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCTACAGGATCAAGATTAGATTATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCTGGAGGGACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCAGCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAACTCATCAGGAGATACAAGTATTTGGAAAAGGCATTTGAGGACGAAATGAAAAAGCTTCTCCTCTTCCTTAAAGCCTTTTCCGAAACAGAGCAGACCAAGCTGGCGATGCTGTCAGGCATCCTGCTGGGCAACGGCACCCTTCCTGCCGCCATCCTCACCAGTCTCTTCACCGACAGCTTAGTCAAAGAAGGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCCAACTCTGTTACCTCTTCTTTGAGAAAAGCCAACTTAGACAAGAGGCTGCTTGAACTCTTTCCAGTTAACAGACAGAGTGTGGATCATTTTGCTAAATACTTCACAGACGCAGGACTAAAGGAGCTTTCTGATTTCCTGCGAGTCCAGCAGCCCCTGGGCACCAGGAAGGAACTGCAGAAGGAGCTCCAGGAGGAGCGTCTTTCAGTGATGCCCGATCAAGGAGGTGGTGCTCTATGTGAAAGAAGAAATGAAGAGGAATGACCTTCCGGAAACAGCAGTGATTGGACTTCTGTGGACCTGTATCATGAATGCTGTTGAATGGAACAAGAAGGAGGAACTCGTGGCAGAGCAGGCCCTTAAGCACCTGAAGCAATACGCTCCCCTGCTGGCTGTGTTCAGCTCCCAAGGCCAGTCAGAGCTGATCCTTCTCCAGAAGGTTCAGGAATACTGTTACGACAACATCCATTTCATGAAAGCCTTTCAGAAGATCGTGGTTCTCTTTTACAAAGCCGATGTGCTGAGTGAAGAAGCAATTTTGAAATGGTACAAAGAAGCACACGTGGCCAAAGGCAAAAGTGTTTTTCTTGACCAGATGAAGAAATTTGTTGAGTGGTTACAAAATGCAGAAGAAGAATCCGAATCGGAAGGTGAGGAAAATTAGATGACTCGAGAAGCACAATACCTAGGGTTACTACACAATACTTTGATTGGGAATGCTGAACCATTCGAGAAGAGAAACTTGGCTTCTGTTTTCACAAAGGATTAAAAATAGGATAGGGTTCCCTTGTGCAGAAGGGGAAAAGTGGTTTTGTTTTCATTTTGTTTTTAAATGGAGCCCTGAGGCATCAGCTATTACACTTGGGACTCTACCTCTCACTCACTGTATGCTAACTTAAAGCCATTCAACAAGGAGTCAAGTAGGAATCTGAAAGTAAATACTCAACGGACTCCTCTTTTTTAGCTGTATTTTTCAGGTACTGTGTGGTGAATGCCCCACTGGTGTCTATTACAGGGCCACTTTGGTAGTTGTGTATCTGCTCGTGTATGTGATTTGACAAACCAGTTTTTTTAAATAAATGGCTTTATAAAAATCTGG