Transcript asmbl_25287

Sequence
Transcript Sequence for observation asmbl_25287 of TGE0004542:
GAAAAGGGTAAAGGAGCGACTCCAGCCCGCCGCTTCCTCAACTTGGGGCTCGCTGTCTCCGGCTCCGCTCGGGTAAGGGGCTCTGCAGCGACGTGCGCGGAGAGGGGCCACCGTGGGAAACTGGCCCCAGAAGAGCCAGGGCGGACTCCTGCTTCCAAGAGTCTCCGGCTTGTCGCTCCTCACGGCCCAGTGCCCCCTCCATCAGGTCCTCCAGCCAGAGGACAGGCATGGCGAGGCCGGGAGGCTCCTGCCTTTGCAGCTGTTTGGCTGTGCTCTGCCTCCTCCCCTCGCTGAGCCTGGCGCAGTACGAGAGCTGGCCCCACTACCCCGAGTACTTCCAGCAGCCGGCTCCCGAGTACCACCGGCCTCAGGTGCCCTCCGACGTCACCAAAATCCAGCTGCGCCTGGCGGGTCAGAAGAGGAAGCACAGCGAGGGGCGGGTGGAGGTGTACTACAACGGCGAGTGGGGCACCGTGTGCGACGACGACTTCTCCATCCACGCGGCGCACGTCGTCTGCCGGGAGCTGGGATACGTGGAGGCCAAGTCCTGGACCGCCAGCTCCTCCTATGGCAAGGGGGAAGGCCCCATCTGGTTGGACAATATCTACTGCACTGGCAAAGAGGCGACCCTTGCAGCCTGCTCCTCCAATGGCTGGGGTGTCACCGACTGCAAGCACACAGAAGACGTGGGTGTGGTGTGCAGTGACAAAAGGATTCCTGGGTTCAAATTCGACAATTCCTTGATCAACCACATAGAGAACCTGAACATCCAGGTGGAAGACATCCGCATCCGAGCCATCCTCTCCGCCTACCGAAAGCGCACCCCTGTGACGGAGGGCTACGTGGAAGTGAAGGACGGCAGGGCCTGGAAGCAGATCTGCGACAAGCACTGGACGGCCAAGAATTCCCGTGTGGTCTGCGGCATGTTTGGCTTCCCTGGGGTGAAGACGTACAACACCAAAGTGTACAAAATGTTTGCTGCCCGGAAGAAGCAGCGCTACTGGAGGTTCTCCATGGACTGCACGGGCACAGAGGCCCACGTCTCCAGCTGCAAGCTGGGCCCTCGGGTGTCCCGGGACCCCGTGAAGAACATCACCTGTGAGAATGGGCTGCCGGCTGTGGTGAGCTGTGTGCCTGGCCAGGTCTTCAGCCCTGATGGACCCTCAAGATTCCGGAAAGCTTACAAGCCAGAGCAACCCCTGGTGCGGTTGAGAGGTGGTGCCAACGTCGGGGAGGGCCGCGTGGAGGTACTCAAGAATGGAGAATGGGGTACCATCTGTGACGACAAGTGGGACCTGGTGTCTGCCAGCGTGGTCTGCAGAGAGCTGGGCTTTGGGAGTGCCAAAGAAGCCATCACTGGCTCCCAGCTGGGGCAAGGGATAGGACCCATCCATCTCAATGAAATTGAGTGCACGGGGAATGAAAAGTCCATCATAGACTGCAAATTCAATGCTGAGTCTCAGGGCTGCAACCATGAGGAAGATGCTGGTGTGAGATGTAATATCCCCGCCATGGGCTTCCAGAAGAAGCTGCGCCTGAACGGGGGCCGAAACCCCTACGAGGGCCGGGTGGAGGTGCTGGTGGAGAGGAACGGGTCCCTCATATGGGGGACGGTGTGTGGCGAGAACTGGGGCATTGTGGAGGCCATGGTGGTCTGCCGGCAGCTGGGCCTGGGGTTCGCCAGCAGCGCTTTCCAGGAGACCTGGTATTGGCACGAAAACATCAATGCCAATAAAGTGGCCATGAGCGGAGTGAAGTGCTCTGGAACGGAGCTGTCCCTGGAACACTGTCGCCATGACGAGGATGTGGCTTGCCCCCAGGGCGGAATGCAGTACGGAGCTGGAGTCGCCTGCTCAGAAACCGCCCCTGACCTGGTCCTCAATGCGGAGATCGTCCAGCAGAGCACCTACCTGGAGGACCGACCCATGTTCATGCTGCAGTGCGCCATGGAGGAGAACTGCCTCTCGGCCTCGGCCGCCCAGACCAACCCCACCTCAGGCTACCGGCGGCTGCTTCGCTTCTCCTCCCAGATCCACAACAATGGCCAGTCCGACTTCCGGCCCAAGAACGGCCGCCATGCGTGGATCTGGCATGACTGCCACAGGCACTACCACAGCATGGAAGTGTTCACCCACTATGACCTCTTGAACCTCAATGGCACCAAGGTGGCAGAGGGCCACAAAGCCAGCTTCTGCTTGGAGGACACAGAATGTGAAGGAGATAGCCAGAAGAGCTACGAGTGTGCCAACTTTGGTGAGCAGGGCATCACCATGGGCTGCTGGGACGTGTACCGCCATGACATCGACTGCCAGTGGGTGGACATCACAGATGTGCCTCCCGGAGACTACTTGTTCCAGGTTGTCATCAACCCCAACTATGAGGTTGCAGAATCTGACTACACCAACAACATCATGAAATGCAGGACCCGCTACGACGGCCACCGCATCTGGATGTACAACTGTCACATAGGTGGTTCCTTCAGTGAAGAGACAGAAAAGAAGTTTGAACACTTCAGTGGACTCATAAATAACCAGCTCTCTACGCGGTAAGGCAGCCTACATGGTCACGTGGTCACCTCCTGCCTTTGGGCCACAGCGCATCTTCCCCAACAACTGCAGTCCGACGGACGATCACCACACTCCCCCTCGCCTAGCCCGGCCCCGCCCCATCTGGATACCCTGCGGCCACATCTCAGCTCAAGAGGAATGGGTGTTCCTGACATTTGCTGGGGGCTGCTGCCTGAGCCTGGGAAGGTGTCTGGGAGTGGGCCTTGTCCGCAGGGCTGTGGGAGCAGTGCCACGGGCCATCTTGTCCGGGACCCCAGGCACACAGGTTGTCATCAGCTTGTCCCATCCAAACCAGTCACACCTGCCCCACACCCCACCCCATCCCCAGTCTGACACCACCCCCATCAGCTCACCACAGATAATATGGGGCCATTCTCTCCTCAAATTCCATGTCGGCAAAGCCAGTTTATCGCCCGAGGTGGTCAGGCTGAATCCCATTTCTCCTCCTCTTGGGTCATCTGCAACCAACTTGAACGTCTAGAGCTCTCTTCCAGTTAAACGAACTGCCTGTCCTCTCCTCTCTCTGTTCACGTATATAAAAAATGCTGCCACATTTTCTGATGAAGTGAGCTCAGAGCTGGTACTTCTCCCCTACCCTCAACTCTACATCCTATTTTTCAAGATACCATTATTATATTTTCACGAACTTTGAAACACAAATTAATTTAGTGGCATTTAATATTGGGCATCTGGGCCTTTGGAAGGAAAAACCTGCCCACCTGTGTAAGTGACTCATGGTTCTGTTGTTCTGATTCTGTGGGTAACTGATTCAACGGTGCTATAACCAGGGTCCTGGGTGACAAGGACACTCACCAAACGCCATGTGTCATCACAGACACTTACACATACTTGAAACTTGGAATAAAAGATTTATGATTTG