Transcript asmbl_24520

Sequence
Transcript Sequence for observation asmbl_24520 of TGE0021251:
GGATTCTGAGCCCAGCCTGCAGAAGTTGCCCAAGGACCCTCCCTGTCTTCTGTGGTGGCCGTTGTCCCTCCCTGGGACATGAAGCCACTGGTGGGAGCGCAACAGCTTTGGGGAACTGGCGGGTCATGCCCAGTGTTGTATTGCAGACGGGCGAGGGCGTGAATGACGTGCGGAAGGGAGCGTGTGCCAGCCACGTCAGCACCATGGCCGGCTTCCTGAAGGGGGCCCACGTCACCATCAACGCAAGGGCTGAGGAGGACGTGGAGCCCGAGTGCATCATGCAGAAGGTGGCCAGGGCCTCTGGCGCCAACTATACCTTCCACAGGGAGAGCGGCCGCTTCCAGGACACAGGCCCCCAGGCCCCAGTGGGCTCTGTGTACCAGAAGACCAATGCGGTGTCTGAGATCAAGAGGGTCGGCAAAGACAGCTTCTGGGCCAAAGCGGAGAAGGAGGAGGAGAACCGCAGGCTGGAGGAGAAGCGGCGGGCGGAGCAGGAGCGCCAGCGGCTGGAGGAGGAGCGCCGGGAGCGGGAGCTGCGCGAGGCTGCCCGCCGGGAGCAGCGCTACCAGGAGCAGAGCGCCGGCGGCGAGGCCAGCCTGCAGAGGAAGTGTGAGCAGCAGGACGTGGCTCTGAGGAACAGAGAGGAGCAGGAGCCCGTCTGCCAGCAGTCAGCACACCCAAGGGAGGTTTTCAGGCAGAAGGAGAGAGCCACGTCCACCACACTCGTCTCCAGCTGCCAGCCAGGCAAACTGAAGAGCCCCTTCCTGCAGAAGCAGCTCACCCAGCCTGAGCTCCCCCTCGGCGGAGAACTGCACGCCACCTCAAGGCCCCGGGCAGGTCTCCATGAGCAGTCAGCAGCCAGCGCCCCAACCTGTCCAGCACAAGCTGGAGAGGAGGCTGTGTATGAGGAGCCCCCAGTGCAGGACGCCCTCTATGAGGAGCCCCCTATGGTGCAGCCGCAGGACGCTGGCGCTGAGCATGTGGATAGCTACCCGGAGCTGAGTGGGAAGGGGCTGTGTGCCCGGGCGCTGTACGACTACCAGGCAGCTGACGAGACCGAGATCTCCTTTGACCCCGAGAACCTCATCACGGGCATCGAGGTGATTGACGAGGGCTGGTGGCGTGGCTACGGGCCGGACGGCCGCTTCGGCATGTTCCCTGCCAACTACGTGGAGCTGATGCAGTGAGGGCCCCGCGCTGCTGGCGGAGGCTCAGGGCCACCCTTCCCTCCCCCCACACGTGTCTTGCTGGAAGTGGGGTGAGAGTTGCACACAGCGCTCTTCCAGGAGTGGGACCCCGGGGAGAACAGGCCCTTGGGCTCCCTCTGGCTCAAGTAGCTTGGCCTCTATCACCCCAAATGCAGCAATAACCCAGTGATTCCTACACATGCTTCCGGCAGCCTCCCAGGCCTCCAGTCAGTACAGCTCTTGACCCCAATAAAGGACATTGAGTCAGGCCTCACCCATGCCAGCCCCTGGGGATGTCTGAGCAGTGGCATCTGGTG