Transcript asmbl_24346

Sequence
Transcript Sequence for observation asmbl_24346 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGGTACTTTCCCCACCCGATACCTTATCCACTTGAGTTGTGAGGGGAAAAAATGGAGAAAGGATTTAAGCCACATTGGTTTCATGGCAGCAAAGCATCCAGATCGGCCACCCATTAACATTGGATACAGGACATTGGTCCAAGCTTTCACAGGTGTCTTGGGGTTTGCGCACAGTCGGAACTGACCCTGGACTAGGCCTTGCTTCTTGCGCCTCCAGTGAGTCCCCTTCATCCCATCACAAAATGAGCAAAGGAAAAATCCTCCCAACTCCTGTAACTTTCTGTCCTCGTCTGCTCACACAGCGGCGACGGAAATGCCCCACCAAGGAGGCCCCACCTCACTGCTCCCGGTTGGTCCTGGGTTCCCTCAGTGGCTTTCTGAATGTAAATAAGGGCCAGAGGCCTTAGAAGATGGAAGTGTTTTTCTATATATTAGAAGTATTTTTTGATAAATTATATATTTTCCTTCCTAGCTGAAGTGTGACTGCCTGTGTGTGACTAACTGAGCCACAGCGCAGCCACCCCACACTCTGTTTGCCCACAGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTAGCTGTGTTTGAGATGAAAATCTGGGGCCAGAGCGGGGCACAGAGGGGAACGGAGGCTGTTGGCCTGGCTTGCTTCAGCAGCTGACCTGGGGAGGCCACAGCGTGTGTGTTCATGGCGCTCGGGCTTGGCTGAGCAAGTCTCTGGGGATGTGGGTGGACAGGTGCTTGCTCAGCCATTCAGAGGCCAACCAAGTAGACCCCCTCGGCAAGGGGTCATGTGAGGAGGCTGAGTACCCGTGTTTCACTCCCAAAATCAAGTGCAG