Transcript asmbl_24093

Sequence
Transcript Sequence for observation asmbl_24093 of TGE0004449:
CTCGGGCACAGTAATGGCAGCGCTGTGAGCAGGGGAACGCGAGTGACAGCCGCCGCCGCCGCCGCCCACCTTCCTCGCCGGGGCCTCGTCCTTCATTCCTTCGGGCTGCCTCCCCTCCCCTTGTCCCCTGCCCCCTGTCCCGCTTCTGCAGAAGATTTCAACACTAAACTTGCACAATGTCTTTGAAACCAAGAGTAGTAGATTTTGATGAAACATGGAACAAACTTTTAACGACAATCAAAGCTGTTGTCATGTTGGAATACGTCGAAAGAGCAACATGGAACGATCGCTTCTCAGATATCTATGCTTTATGTGTGGCCTATCCTGAACCCCTTGGAGAAAGACTTTATACAGAAACTAAAATTTTTTTGGAAAATCACGTACGGCATTTGCACAAGAGAGTTCTGGAATCCGAAGAGCAAGTACTTGTTATGTATCATAGGTATTGGGAGGAATATAGCAAGGGTGCAGACTATATGGACTGCTTGTATAGGTATCTCAACACCCAATTTATTAAAAAGAATAAATTGACAGAAGCTGACCTTCAGTATGGCTATGGTGGTGTAGATATGAATGAACCACTTATGGAAATAGGAGAGCTAGCATTGGATATGTGGAGGAAATTGATGGTTGAACCACTTCAGACCATCCTTATCCGAATGCTGCTCCGAGAAATCAAAAATGATCGTGGTGGAGAAGACCCAAACCAGAAAGTAATCCACGGGGTTATTAACTCCTTTGTTCATGTTGAACAGTATAAGAAAAAATTCCCCTTAAAGTTTTATCAGGAAATCTTTGAGTCTCCCTTTCTGACTGAAACAGGAGAGTATTACAAACAAGAAGCTTCAAATTTATTACAAGAATCAAACTGCTCACAGTATATGGAAAAGGTTCTAGGTAGATTAAAAGATGAAGAAATTCGATGTCGAAAATACTTGCATCCAAGTTCATATACTAAAGTGATTCATGAGTGTCAGCAACGAATGGTAGCAGACCACTTACAGTTCTTACATGCAGAATGTCATAATATCATTCGACAAGAGAAAAAAAATGACATGGCAAATATGTATGTCTTACTCCGTGCTGTGTCCACTGGTTTACCTCATATGATTCAGGAGCTGCAAAACCATATCCATGATGAGGGCCTTAGAGCAACCAGTAATCTTACTCAGGAAAATATGCCAACACTATTTGTGGAGTCAGTTTTGGAAGTACATGGTAAATTTGTTCAACTTATCAACACTGTTTTGAATGGTGATCAGCACTTTATGAGTGCATTGGATAAGGCCCTCACATCAGTTGTAAATTACAGAGAACCCAAGTCTGTTTGCAAAGCTCCTGAATTGCTTGCTAAGTACTGTGACAACTTACTAAAGAAATCAGCGAAGGGGATGACTGAGAATGAAGTGGAAGACAAACTCACCAGCTTCATTACTGTTTTCAAATACATTGATGATAAGGATGTTTTTCAAAAGTTCTACGCAAGAATGCTGGCAAAACGTTTAATTCACGGGTTATCTATGTCTATGGATTCTGAAGAAGCCATGATCAATAAATTAAAGCAAGCCTGTGGTTATGAGTTTACCAGCAAGCTACATCGGATGTATACAGATATGAGTGTCAGTGCTGACCTTAACAATAAGTTCAACAATTTTATCAAAAATCAAGACACTGTTATAGATTTGGGGATTAGTTTTCAAATATATGTTCTACAGGCTGGCGCATGGCCTCTTACTCAGGCTCCTTCATCTACATTTGCAATTCCCCAGGAATTGGAAAAAAGTGTACAGATGTTTGAATTATTTTACAGCCAGCATTTCAGTGGAAGGAAACTTACGTGGTTACATTATCTCTGTACAGGTGAAGTTAAAATGAACTATTTGGGCAAACCATATGTAGCCATGGTTACAACATACCAAATGGCAGTTCTTCTAGCCTTTAACAACAGTGAAACTGTCAGCTATAAAGAGCTTCAAGACAGCACTCAGATGAATGAAAAGGAACTGACAAAAACAATCAAATCATTACTTGATGTGAAAATGATTAACCATGATTCAGAAAAGGAAGATATCGATGCAGAATCTTCATTTTCATTAAATATGAACTTCAGCAGTAAAAGAACAAAATTTAAAATTACTACATCGATGCAGAAAGACACACCACAGGAAATGGAACAGACTAGAAGTGCTGTAGATGAGGACCGGAAAATGTATCTCCAAGCTGCTATAGTTCGTATCATGAAAGCACGAAAAGTACTTCGGCATAATGCTCTTATTCAAGAGGTGATTAGCCAGTCAAGAGCTAGGTTTAATCCTAGTATCAGCATGATTAAGAAGTGTATTGAAGTGCTGATAGACAAACAGTACATTGAACGCAGCCAAGCATCAGCAGATGAATACAGTTACGTAGCGTGATGTCGCTCTCCTCCTGTGTGATGTGAGAAGATCATTGCCATCACCATTTGGCGTGTTCCTGTGGGAAAAAGCAGGCCTGTGCCTCCATAATTTGGTCATTTGGCAGCCCCTGTTTTTCTGCTGTTTACAACATCACCAGTGCCACGTCATGAGCGTCAGAGAAAATGCCTAGAGATATTTCAAGCTCATGTCATTATGACATTTCTTAAAACTTTATTAAAAGAATGAGTGAAGTATTGCTGACATGTGGAAATTTGGTTGGGTACCATGCTTTTTCTCCCCTTCACGTTTGCAGTTGATGTGTTTTTTTTTTAATGTATCTTAAAGGACATAAAATAAAAACTTAAATATTGTAATATGACAGATAACCTTAATAATTGTATCTACATTAAAATGACAAACATGATATTGCTGCTTGTCAAATAAAAAAATAAAGAAGTAGAATGCCTTTTTTATGTGGATGAAGTGTCACACTAAATAATAT