Transcript asmbl_2346

Sequence
Transcript Sequence for observation asmbl_2346 of TGE0004434:
TAGGTGGCAGGTATCGAGTTAGGCCCGGCCCCCTCAAGGCTTAGCCACTCAGGTACCAGGCCCATCCCCCTCCCTTTGGGTTGGGCTCCCTTTTATAAAGGGCCACGCTGTCCCCCACTTGGAAGCAGCTTTTTGGCTCCTCCAGAGTCTGTCAGTTTCGGCTCCTCGCCTTCACTCCAGCCTCCAACATGTCCGTGAGGGTGACCCAGAAGACCTACAAGATGTCCACCTCTGGTCCTCGGGCCTTCAGCAGCCGCTCGTACTCGAGTGCTCCCGGTTCCCGTATCAGCTCCTCGGCCTTTTCCCGGGTGGGCAGCTACCGGGCTGGCCTAGGCATCAACATGAACCTGGCTGGGGGTTACGGCGGAGCTGGAGGTGCGGGGAACATCACAGCAGTCCAAGTGAACCAGAGCTTGCTGAGCCCCCTGAAGCTGGAGGTGGACCCCAACATCCAGGCCGTGCGCACCCAGGAGAAGGAGCAGATCAAGACCCTCAACAACAAGTTTGCTAACTTCATCGACAAGGTACGGAGCCTGGAGCAGCAAAACAAGATTCTGGAGACCAAGTGGAACTTTCTGCAGCAGCAGAAGACGATTCGCAGCAACATGGACAACATGTTTGAGAGCTACATCAACAACCTTCGACGGCAGCTGGACACGCTGGCCCAGGAGAAACTGAGGCTAGAGGCAGAGTGTGGCAACATGCAGGGGCTGGTGGAAGACTTGAAGAATAAGTATGAGGATGAGATCAACAAGCGCACAGAGATGGAGAATGAATTTGTCCTTATCAAGAAGGATGTGGATGAAGCTTACATGAACAAGGTAGAGCTGGAGTCTCGCCTGGAAGGGCTAACCGATGAGATCAACTTCTATAGGCAGCTGTATGAAGAGGAGATCCGTGAGCTGCAGGCCCAGATCTCTGACACGTCCGTGGTGCTGTCCATGGACAACAACCGCTCCCTGGACCTAGATGGCATCATCGCCGAGGTCAAGGCCCAGTACGAGGACATCGCCAACCGTAGCCGGGCTGAGGCTGAGACCATGTACCAGATCAAGTATGAGGAGCTGCAGACGTTGGCTGGGAAGCATGGAGATGACCTGCGTCGCACAAAGACAGAGATTTCTGAGATGAACCGGAACATCAGCCGACTCCAGGCTGAAATCGAGGCCCTCAAAGGCCAGAGGGCTTCCCTGGAGGCCGCCATCGCTGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAGGATGCTCAGGCCAAGGTGGCTGAGTTGGAGGCTGCTTTGAGAAATGCCAAGCAAGACATGGCCCGGCAGCTGCGCGAGTACCAGGAGCTCATGAACGTCAAGCTGGCCCTGGATGTGGAGATCGCCACCTACCGCAAACTGCTGGAGGGCGAGGAGAGCCGGCTGGAGTCTGGGATGCAGAACATGAGTATCCATACCAAGACTACCAGTGGCTACTCAGGTGGGCTGAGCCCGGCCTATGGAAACCTCACAAGTCCTGGCCTCAACTACGGTGTCAGCTTCCAGTCCAACTTCGGCTCTGGGGGGAGTTCCGGCTCTTTCAGCCGCACCAGCTCCACCAAGACCGTGGTGGTGAAGAAGATCGAGACTCGTGATGGGAAGCTTGTATCTGAGTCATCTGATGTCCTGCCTAAGTAAATGGCTACCGTGGTCCCTCTTGGCCTTTCAAGCCTGTGGGAAAGGAGCTGTGCAGAGAGCCTTGAACACAGGAGACCCACCTGAAGCTCAGCCCCAGTTCTCAGCCCCAACCCTGGGTGGGGAATCTACTGCCTGGAGGACCGCCTCTTACCCACGCCCCTAACTAAAAGCCAAATCAAGTGTTTTTTCCAAAATAAAGTCTCAGCTGGCTCTGCCAACCTTA