Transcript asmbl_23299

Sequence
Transcript Sequence for observation asmbl_23299 of TGE0004430:
GGGTAGGGTAGGGTAGCTGAGCAAGTTCGTTCACCTTAGTCCGACTCTTCGTCGTGAGAGAAGCTGGCCAAGGGGGCCGGGGCTTGCACTACACTTCCCGGGAGGCTGTGCGCAGCGGCGCGTCCCGTAACGGGAGCGCGGGCTTTGGAAGGCAGCGGAGCGAGAGGTGATCTGCGGCTGAGCTGAAGCGGTAGCGGGGCTGAGGACTGTCCTGGGCGACACCGGACCAAGCGCTAGCTGCCGAGGCCTCGTGCCCCTAGGCCAGCCGTTCCTCCTCCGTGTCGCTATGGGTATTCAAGGCCTGGCCAAACTGATTGCTGATGTGGCCCCCAGTGCCATCCGGGAGAATGACATCAAGAGCTACTTCGGCCGCAAGGTGGCCATCGATGCCTCCATGAGCATTTATCAGTTCCTGATTGCCGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACCACCAGCCACCTGATGGGCATGTTCTACCGCACCATCCGCATGATGGAGAACGGCATCAAGCCCGTGTATGTCTTCGATGGCAAGCCGCCACAGCTCAAATCGGGTGAGCTGGCCAAACGCAGCGAGCGGCGGGCTGAGGCCGAGAAGCGGCTACAGCAGGCTCAGGATGTTGGGACTGAGGAGGACGTGGAGAAGTTTACTAAGCGACTAGTGAAGGTCACCAAGCAACACAATGATGAGTGCAAGCATCTACTGAGCCTCATGGGCATCCCGTACCTCGATGCGCCCAGCGAGGCAGAGGCCAGCTGTGCAGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCCACGGAGGACATGGATTGCCTGACCTTTGGCAGCCCTGTGCTAATGCGGCACCTGACTGCCAGCGAGGCCAAGAAGCTACCCATCCAGGAATTCCACCTGAGCCGGATTCTTCAGGAGCTGGGCCTGAACCAGGAGCAGTTTGTGGACCTCTGCATCCTGCTGGGCAGCGACTACTGTGAGAGCATTCGAGGCATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTGCGTCGACTTGACCCCAGCAAGTACCCCGTGCCGGAAAACTGGCTCCACAAAGAGGCCCAGCAGCTCTTCCTAGAGCCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGTGAACCAAACGAAGAAGAGCTCGTCAGGTTCATGTGCGGCGAAAAGCAGTTCTCCGAGGAGCGAATCCGCAGTGGGGTCCGGCGGCTGAGCAAGAGCCGCCAGGGCAGCACGCAGGGCCGCCTGGATGATTTCTTCAAGGTGACCGGCTCGCTCTCGTCAGCGAAGCGCAAGGAGCCCGAACCCAAGGGATCCGTGAAGAAGAAGGCGAAGACTGGGGCGGCAGCAGGGAAGTTTAAGAGGGGAAAATAAACAAGTTCCCCTTCAGTACACCTCCGTGCCCAGAGTTATCTGCCCCGTCCCCTTGAGGGCTGGCACTGGAGAAGCCTCCCCTGGGGCAGGGAGGGGACTGCGTTGCTTCTGTGGCATGCGCCTTCTCAGTACTGCAGTTCCCTTTTTTACTTGATCTTATGGCAGGAAAGCCGCAGAGGTACTTTGTTTTCTTCTTTTTTTAGCTCAGGAAAGTATGTCAGCCTCAAACTACCTTTCACTTTAATGGACACTGAATTCATTGTTACGTAAAAGTGATAGCAACAGGTTTTGAAGAAGGGAGAGGGAGAGAAATGGTGGAGACAAAAGACTTTACAGAAGTGATTTCCTGGCTGGCCAGCCGGTGGCCGGTGATGGCGGAACCAGACCACGCTTCTCTGGTTCAGCCTTGACCCACCATGAAGGAAGGACAGCCGGCAGGAAGACCCGGTCTTAGCAAATAGGAAGAGCTACTAAGAAATAAGACAGGCAGAGAGCTGGAGTACATGGACTTGGCAACAAGGGTTCGATTACTGGCTGTGTGTCCTGGGGTGGGCAGAAACTTGAACTTGCTGTGTAACTTGAGTCTTTAGTCATTATTTAGAGGCATAAGGTGGTGAAGTTCTTCTCATGGCCTTTCTGAGGCAATCAACTGAGTCGAGACTTTGGGAAAAGATGCTGTTATGTTTTTGTTTTAAGGTTATGAGAAAAGAGTCAATAAAATTATAAAAGTAACCAGAA