Transcript asmbl_23242

Sequence
Transcript Sequence for observation asmbl_23242 of TGE0004418:
CCGGCCCCCTGCAGCGGCCTCAGAGGTGTGGGTGTGCTGGACTGGGGGAAACTGGGTGTGGCGTGAGTGGGATCGCCCGGTTGGGGCAACTGCTGTGCAGCCAGATAGGGTCTGGACTTTGCGTAAAGGGACGGATGGAAATTGAAGAACGGAGATGGGGACCAGGAGGGAGGGAAGGACTGGGGGTGAGCAAAGGGGCGGGGCCCTGGCTGCTGTGGCCTCCCCTGACCCCCTCCCCCCGCTGCTGGGGTCCTCGGGCAAGCCCCCTTCTCACTGGACTGAGACATGAGGCTGAACTGGGTCCTGACAATACTGTCCATCTGCCTGAGCGCCCTGGCCACGGCCGCAGGGGCCGAGGGCAAACGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTAGACCACTGTCCCATCAAATCGCGCAAGGGGGACGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAATTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTGGGCACGGGCCAGGTCATCAAGGGTTGGGACCAGGGGCTGCTGGGGATGTGTGAAGGGGAAAAGCGGAAGCTGGTGATTCCATCAGAGTTGGGATATGGAGAGCGGGGAGCCCCGCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAACTGCTCAAAATCGAGCGACGTTCAGAACTGTAGCAAAGCTGGGGAGGGGCAGCGGAGAGGCCATCAGGGACCAGACTGTTTAAAAGAAAAACAAAAACAAA