Transcript asmbl_23222

Sequence
Transcript Sequence for observation asmbl_23222 of TGE0004413:
GCTTAGTGCTCCAGCCCCCGCCTCCTGCAGCAGCCCGGTGGGGGGTGGGGAGGCGGGACCGGGTGGCGAGGTTGTGGTCTCAGGGCCGGGCGTGGAGCTGACATTATGTACGTCCTGGCCCACTGTGCCAGCTCGGTACCTGTCCGGGCAGTTGCCATCCATTGTGCGACAGCGGCGGCAGCCAGAGCGTACCTGGAAGGAGGTCTACAGTGGACGCTTGGCAAGGCCCGCGGTTTCAGAAGCGCCGCTGCAGCTATGGCCCCGATCAAGGTGGGAGATACCATCCCGTCTGTGGTGGTGTTCGAAGGGAAGCCTGAGAACAAAGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAGGGGGTGCTTTTTGGAGTCCCTGGGGCCTTTACCCCCGGTTGTTCCAAGACCCACCTGCCAGGGTTTGTGAATCAGTCTGGGGCTCTGAAGGCCAAGGGGGTCCAGGTGGTGGCATGTCTGAGTGTTAACGATGTCTTCGTGACTGAAGAGTGGGGACGAGCCCATAATGCAGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACGGATTTGTTGCTAGATGATTCATTGGTGCCCCTCTTTGGGAATCGACGGCTCAAGAGGTTCTCCATGGTGATCGAAGATGGTGTAGTGAAGGCTCTGAACGTGGAGCCGGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCGCAGCTCTGAGGCCCTGGGCCCAGATACACTCCTACCCTTTTTTGTTTCACCTGCCCAGCTAAAGGCAGAGGGCCCCAGCCCAGCCTCAGCTAGGGCCACCCGATTGGAACTTTGGCTAGATTTCTTCAATAAACACTTTTGGTTCA