Transcript asmbl_23192

Sequence
Transcript Sequence for observation asmbl_23192 of TGE0021204:
TTGGAGGCTTCCCCCACATTGTTTTAAAAAGTGTTTCTCCGTGACTGACCGCTGGGGCTTTCTGACCGCCTGAGGTCTTGGGCTATTTGGTCACCTTCCTTCTCGGTCCCCCAGAGGGCAAAAGGACCAGAGTGACCTCCTGCTGATCGATCTCCACACCCGAGGGTTTCTTGGACTCAGGTCGGAGCTGTGTGGACCCGCCCCCACTCCTGTGTCACCATGTCCGTGTCCACCCAGCAGCTGGCCGAGGAGATGCAGATCTTCGGCCTAGAGTACGAGGAGCCTCTGATTGAGAAATTGGCGGAGCTGTGCGTTCTGCATGGAGAGAATGAGGCGGGAATGGTAGGCGAGCTCATAGCCTTCTGCACCAGCACGCAGAAAGATCGCCTCACCGCAGAGACCCTGAACTCTTTTGAGCATGAGGTTCTGAGCAAAAGATTGGCCAGATCCCGGCACAGTGCCTCCAAGGACAGTGGGCACGCGGGAGCTAGAGACATCATTTCCATACAAGAGCTAATCGAAGTGGAGGAGGAAGAGGAGACCCTTCTGAATGCCTATTCCACACCCTCCAAGGGTTCTCAGAAGCGAGCTGTCACCACCCCAGAAACCCCCCTAACCAAAAGGAGAGTGTCTGCTCGCAGCCCCCACCAGCTCCTCTCACCATCGAGTTTCTCTCCAAGTGCTACTCCCTCTCAGAAATACAACTCGAGGAATAACCGAGGAGAAGTGGTTACCTCCTTCGGCTCGGCCCAGGGAGTGTCTTGGTCCGGGAGAGGAGGAGCCGGCATCATCAGCCTAAAGGTCTTGGGGTGTCCAGAGTCACTAACCGGGAGCTACAAATCAATGTTTCAGAAGCTGCCAGACATTCGAGAAGTTCTGACCTGTAAGGTAGAAGAACTTGGCAGTGAACTCAAGGAACATTACCAGATCGAGGCTTTTGCTCCTGTTCTAGTTCCAGCACAAGAGCCCGTCACTCTGCTGGGCCAGATTGGCTGTGATAGCAACGGGAAGCTGAACAACAAGTCGGTGATTCTAGAGGGGGACCGGGAGCATTCTTCCGGCGCTCAAGTTCCAGTGGATTTATCTGAGCTCAGAGAATACTCTCTGTTTCCTGGACAGGTTGTAATTATGGAAGGAATGAACACGACTGGTAGAAAACTCGTTGCCACTAAACTCTATG