Transcript asmbl_23007

Sequence
Transcript Sequence for observation asmbl_23007 of TGE0004379:
AGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAA