Transcript asmbl_22927

Sequence
Transcript Sequence for observation asmbl_22927 of TGE0021176:
CGCGGGGCCGCGGTTGGCCGGAGGGAGCCGAACCGCTTCCGGAAGTGGCCGATCTGTGGGGTCTCTCTCTCCGACCCGAGCCGAGCGCCGGGCCTTGTTCTCCGGATCGGCCGAAGGTGTTCCGGAAGGAGGCGAACCCCGAGGCGGGCAGGGCCAGCCGTCTCTGCCGCCGACAGAGCCCAACGTCTGCTGGGGCTTTGAGAGGGTGGGGGACTCCAGAGCCTGGCTCCGGGCCGTCGGGAGCCGAACTCGTTCCGGAAGGAGCCGAGGAGACCGGCGCCGGCCTCGGCGTCCCGGGTGTGAGGCGGTGGCAGCCGCGGCGACAGCGCGGGCCGGGATGAACCGCGACGGCTGAGGCGGCGGAGGTGCCGGCTGCGTGGGCCCGACCGAGACTTCCGTGAAGCGCCAGCCCCGCGCTCCGGGCTTCGCCTCGAGCTGAGCTCTGCCCCCCCGAGCCTCCAGGTCCCCTTTGTGCGGCCGGAGGAGGCGGCGGGAACGGCCATGGCGGCCAACATGTACCGAGTGGGGGATTACGTCTATTTTGAGAACTCGTCCAGCAATCCTTACCTGGTTAGACGGATTGAGGAGCTCAACAAGACTGCAAATGGAAATGTGGAGGCAAAGGTCGTGTGCCTTTTCCGGCGGAGGGACATTTCTAGTAGCCTCAACAGCCTGGCTGATAGTAATGCCAGGGAGTTTGAGGAGGAATCAAAGCAGCCAGGGGTATCGGAGCAGCAGCGACATCAACTGAAGCACCGGGAGCTTTTCCTTTCTCGGCAGTTTGAGTCGTTACCAGCCACTCACATACGGGGAAAATGCAGTGTGACTCTCTTGAATGAGACAGATATCTTGAGCCAGTACCTGGAAAAGGAGGACTGCTTTTTTTACTCGCTGGTGTTTGACCCTGTGCAGAAGACCCTTCTAGCTGATCAGGGGGAAATCCGAGTTGGTTGCAAGTACCAAGCTGAGATCCCAGATCGCCTGGCGGAGGGGGAATCTGATAACCGGAACCAACAGAAGATGGAGATGAAAGTCTGGGACCCAGACAACCCTCTCACAGACCGGCAGATTGATCAGTTTCTCGTGGTGGCCCGAGCGGTGGGGACCTTTGCGAGAGCCCTGGATTGTAGCAGCTCCATTCGGCAGCCAAGCCTGCACATGAGTGCAGCCGCTGCCTCCCGAGATATCACTCTGTTTCATGCAATGGATACGTTGCAAAGGAACGGCTATGACCTGGCAAAGGCCATGTCGACCCTGGTGCCCCAGGGGGGCCCGGTGCTGTGTCGGGATGAGATGGAGGAGTGGTCTGCCTCAGAGGCCATGCTTTTTGAGGAGGCCCTGGAGAAGTACGGGAAGGATTTCAATGATATTCGCCAAGACTTTCTGCCCTGGAAGTCACTTGCCAGCATAGTCCAGTTTTATTACATGTGGAAAACTACAGACCGCTACATTCAGCAGGTACAGTCTGGGCTAGGGAGGCTGGACGAGAGGGCTCCG