Transcript asmbl_22682

Sequence
Transcript Sequence for observation asmbl_22682 of TGE0000661:
CAGGCCGCAGCGCTAGCGGGAACAGGAGCTTCCGACCGCCCGGGGAGGCGGCGCCAGGACCTTCCCGTAGTGGCTGAGGCAGCGCCTTGGCGGTGGGCGGCATCGGGGACGGTGGGCGCCGAGGGCCGTGCAGCTTCCAGTTGCTGCGGACGCTCGGCCTGGCGTGGCGGATTGCTCGGACCTAACCGGCATCATCGTGCTCCGGGCTCTCCCCTCATGCACTATCGGGCGAGAGGAAGCAGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGG