Transcript asmbl_22681

Sequence
Transcript Sequence for observation asmbl_22681 of TGE0000661:
CAGGCCGCAGCGCTAGCGGGAACAGGAGCTTCCGACCGCCCGGGGAGGCGGCGCCAGGACCTTCCCGTAGTGGCTGAGGCAGCGCCTTGGCGGTGGGCGGCATCGGGGACGGTGGGCGCCGAGGGCCGTGCAGCTTCCAGTTGCTGCGGACGCTCGGCCTGGCGTGGCGGATTGCTCGGACCTAACCGGCATCATCGTGCTCCGGGCTCTCCCCTCATGCACTATCGGGCGAGAGGAAGCAGGTCGGCTCCCGGCTCCCGGCTCCCGGCTGTCGGCGTCCGGAGCCTGCTCTGGGCTGAACCCTTAACGTTCAGAACTTTTCAGACTATCACAGTGTCTTGCAGTTCGTGCCCGTTGGGCTGGTCTGTTCCGGCGCACGTAAAATGTTTATTTGCCACTGTTGTGCACTTGCTATTGGATACAATCTTGGCGCAAAGACGGGCGATTTAGTAGTTTTGGGTGTTCGGTGACAGTTACTCTTTCGGATATTCGGACAAGGCTGACGTTGAGTTAGTTGGGTCGAAGGACCATGTTAATATAGTACAGTTGCTGCTGGATTTTCAGACGTTTGCGAAACGTCGGTGATTCGGCTCCCGTTCTGATAACTGACAGGCCGTAGCTGATATTTTTGTTTTGGTAGCTGGGGATACTGGGGGGACCAGTGTGCTTAGAGATAGGAAAACTTCGCGATGACAGAGGCAGAAAAAAAGATGTGTTCTCACAGTGGAACGATGGGGTGCCTGTTGACAATGACGGTAAAGCCGTGTCCTGTCTTCCCCAACAGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGG