Transcript asmbl_22107

Sequence
Transcript Sequence for observation asmbl_22107 of TGE0004288:
CTCGTCTGAGGCGGAGGCAGCGCCGCGCCGGACCCGAGTTTCTTTCACTTTCTGGGATTGAATTTTGAGCCATCAAAACCATGAGCAACTACAGCGTGTCCTTGGTTGGTCCTGCTCCTTGGGGTTTCCGGCTGCAAGGTGGCAAAGATTTCAACATGCCTCTGACAATTTCTAGTTTAAAAGATGGCGGCAAAGCCTCCCAGGCGAATGTGAGAATAGGTGATGTGGTTCTCAGCATCGATGGAATAAGCGCCCATGGAATGACTCATCTTGAAGCCCAGAACAAGATTAAGGGTTGTACAGGCTCTTTGAATATGACTCTGCAAAGAGCATCTGCTACACCCAGGCCCGAGCCGGTTCCTGTTCAAAAGGGAGAACCTAAAGAAGTAGTTAAACCTGTACCCATTTCATCTCCTGCTGTGTCCAAAGTCACTTCCACAACCAACATGGCCTACAATAAGACACCACGGCCCTTTGGTTCTATGTCTTCACCAAAAGTCACATCCATCCCATCACCATCGTCCGCCTTCACCCCGGCCCACGCGACCACTTCATCACATGCTTCCCCTCCCGTGGCTGCTGTCACTCCTCCCCCATTCGCTGCATCTGGACTGCATGCTAATGCCAATCTTAGTGCTGACCAGCATTCACCTGCACTGAGCGCTGGTAAACCTGCAGTTAATGTCCCACGGCAGCCCACAGTCACCAGCGTGTGTTCCGAGACTGCTCAGGAGCTAGCAGAGGGACAGAGAAGAGGATCCCAGGGTGACAGTAAACAGCAAAATGGCCCACCGAGAAAACACATTGTGGACCGTAACACGGAGTTTTATCACATACCCACCCACAGCGATGCCAGCAAGAAGAGACTGATTGAGGATACAGAAGACTGGCGTCCGAGGACGGGCACAACGCAGTCTCGCTCTTTTCGAATCCTGGCCCAGATCACTGGGACTGAACATCTGAAAGAATCTGAAACTGATAATACAAAGAAGGCAAACAACACCCAGGAGCCTTCTCAGCATTTGGCTCCATCAGTAGCTTCAGCACGGAGCATGCCTGAGAGGCCAGGAAGCCCAGCCTCTGCCAGACCAGGGGTGGCTGGTCTCACAACTGCTGCTGCCTTCAAGCCTCTAGGATCCACCAGCACCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGCAGCACCTTACACTGGAAGAATCTCAAATAGTGCAGCTTCCTCAGGAGCAGTGGGACCAGCCGCCTCCTCTGTGGGGCAGCCCCAGCCAAGTGACCAGGACACTTTAGTGCAACGAGCTGAGCACATTCCAGCAGGAAAACGAACTCCAATGTGTGCCCACTGTAACCAGGTCATCAGGGGACCATTTCTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGTGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTGGAGGAAAAGGGGGCCCTGTATTGTGAGCTCTGCTATGAGAAATTCTTTGCTCCTGAATGCGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAATGCTTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTGGCCTGTGGAAAACCCATTCGTAATAATGTTTTTCACTTGGAGGATGGTGAACCCTATTGTGAGACGGATTATTATGCCCTCTTTGGTACTATATGCCGTGGATGTGAATTTCCCATAGAAGCTGGCGACATGTTTCTGGAGGCTCTGGGCTATACCTGGCATGACACTTGCTTCGTATGCTCAGTATGTTGTGAAAGTTTGGAAGGTCAGACCTTTTTCTCCAAGAAGGACAAGCCTCTTTGCAAGAAACATGCTCATGCTGTGAATTTTTGAAAGTCAACAGTTCAAGAGAAGAGAAGAAATTTGAAAAGAAAGAGGAGAATTAAAATTACCAATTAATTTTTAGATTTAATATTTATATGGAGTTTGAAAAATAATAGTGGCCCTGAAGGGATAAATTCCAGCTTTAAAAACCGAGTCTTTGAAGAAATATTTGGCTACATAACGTAAAGAGACAGTTTGGCATTTATTATTACTTTTTTCCCTGTATTTTCTGCCCATAAAATAACTTTCATAAAAATCAATTTCCTGGTTGACTATTAAATTCATCTTAGAATAAATTAGTAAAGAATTAAATTTTAGAAAATCTCAAACCTCTATGCTGAAATAATTATGGTTTCTTTCCTTGTTATGAGTAAATCTGTAAAAGGCAATGAAAGTGCCTTATACTTTTATCATTAAATGAAACATTGTATTTTTTTTAAGAATAATGTTTATCTTTAAAACAGTAAATAGGAGTTTAAACAGAGCATTTTATCAGTAGGTGTCAATTTTTACAAACTGTGTACATTTTTTTTGTCTTACAATCGATCATTCCAGTAGGAAAGATCAATGAGATTTTTCATCAAAATGCATCATGCCAATAAGAGATGCTATATTTTTCTTCATCCCTTTCAAAAGCTACCTACCATATGGCTTATAAATCTCAAATTTTTGCCTTTTATTAAAATATGGCCATTCCTATTCATTGTGTGTGTTTTATCGCCTATATTAGTCAAACTCTTTTTACCCCCGCTCCTTCATGCTGAGGTAAAGAGCTAATTGGATAACTTTGGACTGTAACAGTTTTCTCTCTATATAAAGAGAATAAGTAGGAAAGAATGTGGTTGTATCCAAAATATTCTCCTCCCCAATTCAGATCATGAATCGGTTTCAGAGTTGTACTACTGACAAGTGAAGGTTTGAGAACTCTCTTTGCAGAGTATTTTTTTCTTTAATTCTACATTAGAAAAATAAAAGATTGGCTTGGGGATGTGATAAAATCTTGATTGTTTTTTTCTTTTGATCATTCTCTTTCAGTAATAAATGAACCACTTCTAAAGGTGATCATGAAGTTTGGAAACTTTTATTCACAGAGGTTTGGTAGTATAGGAGGGCATATGATTAATTACTCAGACTAGCCCATTATTTGTTTTCTTCATTTGGGGAAAATTATGTGGATACCACATGAAGACAGAGAAACAATTGTGGTAAAATTGTAGATCCTATTGATATTTGCCCAGTGAGAAAAGCAATTATGGCATTTGATAGTTTTTCTCTTTGTTTTCAGATATGATGAAAGCCCATGATCCCACTAAGTTATAATTTAAATTCATTTGGAGCAAGATGCTTTTAAAGTTGAGGCTGAACCCGAAGTCTTTCCTGCCCCATCATCACTCACTAATTACTTCACTTCCATTGTGTACATGTTTGTTATAGAGGGAGGTTTTAAGCTACAATATTTGTTTAACCTCCCTAAGAACTTTTCAAGGCATCTGTCCTGAAAGTTGTTAATATATGGTCTAGCAGATTTAAATTATATACAGATAATAATTAACTGGGGATAAAAGAATGAGAAGGATGACACAAAGTGGCAAACTGAATACTTCACTTATAGTAACCCCAAACCACCTCCTCACCTTGCATCTTGCAGGGAGGCAGGAAGTTTTTTTGTTTTTTTTGTTTT