Transcript asmbl_21423

Sequence
Transcript Sequence for observation asmbl_21423 of TGE0004254:
CTTACACTGAAACCCTTTGTTTTTCCCTCCTCTTCCTTCCTCTTTAGAAGGAGACACTCTGAGAAAGAGCGCATTTTGGGGACCCGCTTAATGTGATGTTTTCTTGGTTGCCTCTTCCTTCTTCATCTGCAGGCTGCGGTTCCTGTAACGACAGACGATCAGCTGCCATCTGTCTTCTGGAGGTCACCCCTCTAGGGTCTCTGGGGAACAATGGGAGTCTTGGGCTTCCTCACACTGGAAGCGAACGGCCCCATGCTGACAGTGGCCCTGTCTGTGGTCCTCTTGGCTCTCCTGAAATGGTACTCTACGTCAGCCTTTTCAAGACTGGAGAAGTTGGGCATCAGACATCCCAAGCCTTGTCCTTTTATTGGAAACTTGACATTTTTCCGCCAGGGCTTCTGGGAAAGTCAGATGGAGCTCAGAAAGCTGTATGGACCTCTGTGTGGGTACTATCTTGGCCGTCGGATGTTTATCGTTATCTCCAAACCGGACATGATCAAGCAGGTGTTGGTCGAGAACTTCAGTAACTTTACCAACAGAATGGCATCGGGTTTGGAATCCAAACCGGTAGCAGACAGCGTGCTGTTTTTACGTGACAAAAGATGGGAAGAGGTCAGAAGTGTTCTAACTTCTGCTTTCAGTCCTGAGAAGCTGCATGAGATGATTCCTCTAATCAACCAAGCCTGCGACCTTCTCCTGACTCATTTAAAACACGATGCGGAACGTGGAGACGCTGTCGACATCCAGAGGTGCTACAGCTGCTACAGCACAGATGTGGTGGCCAGTGTCGCCTTCGGCACCCAGGTGGACTCCCGAAAGGCTCCTGAGGACCCCTTTGTCAAGTACTGCAGGCGTTTCTTTGCCTTCGGCATCCCCAGACCTCTCCTGGTTTTCATCGTATCATTTCCATCCATAATGGTCCCACTGGCCCGGATTTTGCCCAATAAGAACCGAGATGAACTGAATGGCTTTTTTAACAAACTCATTAGGAATGTGATTGCCTTGCGGGACCAGCAAGCAGCAGAAGAGAGGCGGAGAGACTTCCTCCAAATGGTCCTGGATGCCCGACAATCCACCCCTTCCGTGGGCGTGGAGAGCTTCGACATAGTCAGACAAGTCTTCTCATCCTCCGAATGCTCAGCGAATCCTTCCCAGCAAGGCCAGCCCAGACCCCTGTCCAAGCCCTTGACTGTGGATGAGATCGTGGGCCAGGCCTTCCTCTTCCTCATCGCCGGCTACGAGATCATCACCAACACACTATCTTTCGCCACCTACCTACTGGCCACCAACCCTGACTGCCAAGAGAAGCTTCTGACAGAGGTGGACCGTTTCAACGAGAAATATGCGACCCCCGAGCTCTGCAGCCTCCAGGAAGGCCTGCCCTACCTGGACATGGTGATCGCAGAGACCTTGAGGATGTACCCGCCAGCTTTCAGGTTCACGCGGGAGGCGGCAAAGGACTGCGAAGTGCTGGGGCAGCGCATCCCCGCCGGCACCGTGGTGGAGATGGCCGTGGGCGCCCTGCACCGCGACCCGGAGCACTGGCCCCGCCCCGAGGCCTTCGACCCGGAGAGGTTCACGGCGGAGGCCCAGCGGCGCCGGCGGCCCTTCACCTACCTGCCATTTGGAGCGGGGCCCCGGAGCTGCCTCGGCGTGAGGCTGGGGCTGCTGGAGGTCAAGCTGACGCTGCTCCACGTCTTCCGGAAGTTCCGGTTCAAAGTCTGCCCCGAGACTCAGGTGCCACTGCAGCTAGAATCCAAATCTGCCCTAGGTCCGAAAAATGGTGTCTACATCAAGATTGTCTCCCGCTGACAGTTAAGAGGGCACCCCCTAATTCGAGGAAAACTTTCATGTGGAAATTCAGATATTTGGGGAGACATCACCTTAGCCATTGAAAGGGTGTCTGGAATGCAAGTATACAAGAAGTCATTTACATAACATGTCCTAAATGCT