Transcript asmbl_21321

Sequence
Transcript Sequence for observation asmbl_21321 of TGE0015139:
GGTAGTGGCTCCAATCCTTTTCGGCATCTGGAGAAGAGCGCTGTTTTACAGGAGGCTCGTCTGTTCAATGAAACACCCATCAATCCAAGAAGATGTTTGCATATTCTTACAAAGATTCTTTACTTACTGAACCAGGGTGAACACTTTGGAACTATGGAAGCCACAGAAGCCTTCTTTGCAATGACTCGATTGTTTCAATCTAATGATCAAACATTGAGAAGAATGTGCTACCTTACCATCAAAGAAATGGCTAACATCTCTGAAGATGTGATAATTGTCACAAGCAGTCTGACCAAGGACATGACAGGAAAGGAAGATGTGTACCGAGGCCCGGCCATCAGGGCTCTCTGCAGAATCACCGATGGAACAATGTTGCAGGCCATTGAACGATACATGAAGCAGGCCATTGTGGATAGAGTCTCCAGTGTATCCAGCTCAGCACTGGTATCTGCCTTACACATGATGAAGATAAGCTATGATGTGGTTAAGCGCTGGGTCAATGAAGCCCAAGAAGCTGCTTCAAGTGATAATATTATGGTCCAGTACCATGCATTGGGAGTCTTGTATCACCTTAAAAAGAATGATCGCCTTGCTGTTTCGAAGATGTTGAATAAATTTACTAAATGTGGTCTCAAATCACAATTTGCTTACTGCATGCTGATCCGAATTGCCAGTCGCTTACTAAAAGAAAATGAAGAGGGTCACGAAAGTCCACTCTTTGATTTCATTGAGAGCTGCTTGCGAAATAAACATGAAATGGTTATTTATGAAGCTGCTTCAGCTATCATCCATCTACCTAACTGTACTGCAAGGGAGTTGGCACCTGCTGTTTCAGTTCTTCAGTTGTTCTGTAGCTCTCCTAAGCCAGCTTTGAGATATGCAGCTGTGAGGACCTTGAACAAGGTGGCGATGAAGCACCCCTCTGCTGTTACTGCCTGCAATCTGGATTTAGAAAACTTGATCACAGACTCAAACAGAAGCATCGCCACCCTTGCCATTACTACACTCCTCAAAACAGGAAGTGAGAGCAGTGTGGACAGGCTCATGAAGCAGATATCTTCTTTTGTGTCCGAAATCTCAGATGAGTTCAAGGTGGTGGTTGTGCAGGCAATTAGTGCTCTCTGTCAGAAATATCCTCGAAAGCACAGCGTCATGATGACTTTCCTCTCCAACATGCTCCGAGACGATGGAGGCTTCGAATACAAGCGGGCCATCGTAGACTGCATAATCAGCATTGTGGAAGAGAACCCAGAGAGCAAAGAAACGGGCCTAGCCCACCTTTGTGAATTCATCGAAGACTGTGAACACACTGTTCTGGCTACTAAGATTCTACACTTGTTGGGCAAAGAGGGCCCCAGAACGCCTGTCCCCTCCAAATATATCCGCTTTATTTTTAATAGGGTCGTACTGGAGAATGAGGCTGTCCGAGCTGCTGCTGTGAGTGCTTTGGCTAAATTTGGGGCTCAGAATGAGAATCTTCTCCCAAGCATCCTTGTACTCCTACAAAGGTGTATGATGGATACTGATGATGAGGTACGGGACAGAGCTACCTTCTATCTGAATGTGCTGCAGCAAAGGCAGATGGCACTGAATGCTACATATATCTTCAATGGTTTGACAGTTTCTGTTCCAGGGATGGAAAAAGCCTTATACCAGTACACATTGGAGCCTTCAGAAAAACCATTTGACATGAAGTCTATTCCTCTCGCTATGGCTCCTGTCTTTGAACAGAAAGCAGAAATCACACTTGTGGCTACTAAGCCAGAGAAGTTGGCTCCTTCCAGGCAAGACATTTTCCAAGAACAATTGGCTGCTATTCCTGAGTTTATGAATCTAGGACCCTTGTTCAAGTCTTCTGAGCCTGTTCAACTTACAGAAGCAGAAACAGAATATTTTGTTCGTTGTATTAAGCACATGTTTACCAACCACATTGTGTTCCAGTTTGACTGTACCAATACTCTCAATGACCAGCTACTGGAGAAAGTGACAGTGCAGGTGGAACCATCAGATTCCTTTGAAGTGCTGTGTTACATTCCCGCCCTCAGCCTCACATATAATCAACCAGGAATATGTTACACTCTTGTCCGTTTGCCCGATGATGACTCTTCAGCAGTTGCAGGCACCTTCAGCTGCACCATGAAGTTTACTGTCCGGGACTGTGACCCTGACACTGGGGTCCCAGCCGAGGAGGGGTATGATGATGAGTACGTGCTGGAAGATCTTGAAGTGACTCTGTCTGACCACATTCAGAAGGTCCTGAAGCCTAGCTTTGCTGCTGCCTGGGAAGAGGTGGGAGATACCTTTGAGAAAGAGGAGACCTTTGCCCTCAGTTCTACCAAAACTCTTGAAGAAGCTGTCAGCAACATCATCACATTTCTGGGCATGCAGCCATGTGAGAGGTCGGATAAAGTACCTGAGAACAAGAATTCTCATTCCCTCTATCTGGCAGGTGTGTATAGAGGTGGCTATGATTTATTGGTGAGGTCAAGGCTGGCCTTAGCAGATGGCGTGACCATGCAGGTGACTGTCAGAAGCAAAGAGGGAACACCTGTAGATGTTATCTTGGCTTCTGTTGGATAAGTTTTTTGGGGGGATGGGGCAAGATGAAGTTGATGTACACTTCACTGCAGTGGGCTTTTAGGGCTAGTGGCATGAATTTCCCAGAATCATACTTTGAAAAATTAATGACTTTGCAGAAGCAAATTAAATGTTTGGCCCTGAGCCAGCAGATCAAGCAAATATCTGTCCTTGTGCATGTCTTTTTATTACACTTGGTCAACTTTGGTATGATAGTACAGCTTCGGGTGATCTTGAAAAGCAAATACTATCCTGTACCCCAGCTGCTTAACTTCATTATATTGTTTAATTTAACGTGTGTCTGAAAGCTCCTGGCAATGTTGAAAAGCTTTTATCCCAGAGGGGTGGTGGGGGAGGGGAAGGCAGAGTCCACTTTTGTCAAAATTCAT