Transcript asmbl_21320

Sequence
Transcript Sequence for observation asmbl_21320 of TGE0004232:
GACACTGTAGCCTCAGTCGAGAATCACTCAGATTCACTATCCACTGGTGAACAGGCGGATCCAGCCATAGCCAAACCAAGCATCGTAACAACCAGTGATACGGTCAGTGCAAACACAAAGATGGCACCCAGCGACTCGGAAAAATCGGGGATACCAGCCTCAGACAAGAATATTGCCATTGCTACTGGCTCAAAGACGACTCAAGATCCAGCTCAGAAGTCTATTACACCAACTACTGTCCTGATGAAGACCGAAACCAAAAGCAGCCAGGATGGACTTAAAACTGCACCTGGAACGAAAGTCCAAAGTAGTCCCAGTGTTACTGCGAGCATGACCACGCAGGGAGGTCGCACGGACCTCCAATCTACACAACATCTGAGTAGCTCCACAGACAACAGTCCTGCCCTTTCTTCCTTGACCACCCCAGCGAGCACACAACAGCTGACTCCAGGCTCTCCCAAGGGACCAGACCAAATGACGACAGCTTCAAGTAGTTCAGGCACAACGGCAGGTTACACCTTCACCCCTTCACATCCGAGGACGGCTACCACACTGAGATCATCGATTACCTCGCAAGATCTGCCGACCCCCAGCAAGATGCCAGCCATCACTGGGAACCATTCCTCCACCCCGGGGACCCCTTCCTCCATCCCTGGGATAGCGACTTCTTTGTCCAACACTCTGCAGCCTACGTCTTCATCGGGACCTGTGGCCACATCTTCTGGCGGAACCACAAGCTTCCGTACTCAGTTGGCTCCAACTGCCCCCCAAGACTCCAACATCTCTACTCCCCCCTCGGTTTTCGAGGATGACAGGATAACCTGCACGAAGACCGACCGAAGTCTGAACGAGTCGATGCTCATCTTGAACCTCACGAAAACCGTCCACTGCGCGGGGAGCCCTCTGGATGACAAACTGGTCACACTTCTGTGCCGAGCGGCTAAATCTGCCTTGAACCCAACTCAAGACCAGTGCCACATACATCTGATAGTCAGTTCAGAAGGCCAGGCAGTGGCAGTCGAAGAGATCACTATTCGAACAAAACTCGTTCTTAAGGACGTATATGAATCGCTGAAAGACAAATGGGATGACCTGAAGGAGATGGGAGTCAATGACATGAAGCTTGAGGGTCAAGGACCACCAGATGAGACTGAGGACCGGTTCAGCAAAAAATATTGTCTGCATGGCATCCTTTCTGCTCCTCGTGGCGGCCCTCTATGGCTGCTGCCACCAGCGCCTCTCCCAGAGGAAGGACCAGCAACGACTAACGGAGGAGCTGCAGACCGTGGAGAATGGTTACCATGACAACCCAACACTGGAAGTGATGGAGACCTCATCAGAGATGCAGGAGAAAAAGGTGGTCAACCTTAACGGGGAGCTGGGAGACAGCTGGATCGTCCCCCTGGACAACCTGACCAAGGATGACCTAGATGAGGAGGAAGACACACACCTCTAATCCGGTCTGCTGGCGGCCTCCGACGGTGCCACAGAGCTCCAGACCGGACCACCTCAAGTGCCATTGGGACAGGGGAGGAAAGTCCTTCCCATTTGAGGGAAAGACTGGGGAGGGAGCAGACTTGGAGGGTTCCCTCCTCCTAATCCCGCAAAGGGCCTTAATTTTTCTCTTTCAAACTGAACAAATCATATCCTGTCTAGATTCCTCTTGTAAAATAACCTACTAGTGCCTGAGCTCAGTGCTGCTGGAAGATGAGAGAGAGGAAGGGAAACCAAGAGTGAGCCATACTGGGGACGTAGAGATCAGCTAGTCGAATCCCTTCATTTCACAGATGAGATGACTGAAGCCCGAAGAGGGTAAAGTCAAGGGTGACACAGCCACTTGGTGACAGAGTCAGGATGAAAACAGATTCCTTCCTGCAGGCCAGTGCTCGTTCCACCCTGCCACACTGCTGCGATCCCTCGTGCCCTCCCTCCAGAGCTGCCCCGGGCTGGGGGTGGAGCTGCCAGATGATGGATGGGACAGAAGGGAGAGCAGCGGGGCCCGATCCTGCCTCAGCGGGATCTGGTTCCTTGAAAGCATAGGTCCCAGTTCTGTCTCCTACCCCAGCCTCGTCTGCCATTGTTCTCGTCCCCTTTGTTCTTCCCCTTCCATTCACTCGATTTTTATTCCCATTCTGCCCCAGGATCTTGAGACTAACACAGGTCATTCATGACCTTGAACCCCTTGTCTGGATTCTGGTTTCCTGCCATTTGCTTAGTGAGACTGGGACTTGGACCACACGAGACTCCCAGCGTGAACGAGGTCTGCTTAGGGGTCCGTCTACAGGTGGAGAGCTGGGGAAGCCCTTCCTCCCCGGGTGTGTCCTGGCCCATCACCCAAGGGACTCCCTGAAGAGGCTTCCCAAGTGTTCCATTGGCCTCTCTTCCCCACCAGGGGCTAAATTCCACAGCTAATGAAGGCAAAGGGTTCCTATACTGTTGTTCACTGCTCAGCCAACGGGGGTGAAAATCCCAGCTAGGAAACCCCAAGATTAGCGCGAATGGGCGGCATTCGGACAGACTTTCCCAGGGCCCCAGTCAGCAGAGAGGGCGTCTTGACAGACAATCGAAGGAAGGCCGGGGAGGCTAGGCTCTTCTATTTCATAGGAAACTCAGGGACTTTTCAAGTTGCTGAGAGTTTTGTTATGTTTTCTAACCCAGCCCTCTACTGCCTAAGGCCAAAGCTCAAATTGTAGAGACTTTCAGTGAGCTAAACTCACTGATTAGAGTCTCCTGTGCCATAGGGCAAGAGAGGCCTAGAACATGAGGTGCATTTTAAGGTGCATAACGGGCAGCCCGGGGGCATGGCCGTCTGTCTGTTCTCGGTAACCCCTCACTGTCCTGGCATGGAGCCATGTCCTCTTCTCTGTAGTCCTAGTGGGGCTGCCCTGTTGTCCTGCAGTTTCTGGTAGCATCTCAGGGAAATAAAATACTATCTGTTCCTCAGTAGAGGAGATCTGAGGGGCTCAGCAGTTAGCCACCATGTAGGAAGACTAGGCGTGGTGAGGTTTAATCTGATTTTCTGACGAGAGAATCCTGTGTGGGATTTTGAACTTTGCCCATGGTCACTATTGTTCCTGGGCGTAAGATCCCTGGAATTAACTAGGAAGATGGGCAGCACTGCTTAGGAGAGTGAAAACTGTCATTTCGGGCCAAGAGTCAGAACCCCAGAATGCAGAGGGATGGTTCTGATGACATAGGCTCTCAGATTTGGGATAGATTCTTTTATTAAAAGGGGAGGAGTTTAAGGGGAAGATCTGTGTCCCTCCGTGGCTGCCTGATTCCTTCTTCATAGCTTCTCGCCCGTTGGCTTTGGGGTTCAAGTAGGGGCCCCAGTGAATTTCTCAAGAGTTAGAGAGATACAAAGCTAACAAGGATCCAAAAGCATTCGCCCTGGTTCTCTAGCATGTGGAGGTTGGCAGGATGGAGAACAGTGCCAGTTTGGGGGAAAAGGAAGGATATCTTGTCATGTTGGGAAAAGATCTGGTCACTTCCTTCCTGTCCCGTATTTGGTTCTTTCTATCATGGTGTCTGTGGGAAAGGCCAGGCCGGATTACGGCTCCTATGCTGATTCTGCGTAACATTTCACCAGCCAGGCCTTGAGACCGAGGTAGCAAATATGCCTCTGCAAACTGATCAAAGGTCGCAACCTGTAGGCCTCTTGGGGAGATAGACAATGCCTGGAATGACTGTGGCTCTAAGGAGACCTCTGAGAAGCACTGGGCTGGTTCAGAGGTTCCTTCTTGAGGTCCATCCACATTGTGTTACTCTAGCTTTTTAGGGCAACTTCAGAATCCAATACCTTGCCTCGGCTTGTTCTTGCCACTAGACATCTATGTCAAAGGCCACAGAGCCATGCATCTGCAAAGGACATCTTCTTCCCATCTTTCTACTGGTTTCTAAATGCTGTCAGGTAATTCAGATTCTGGGGCTGAGAAGAGAGAAGAGGAATACCGGCCACTCAGCATGACTTTGAACAAGTTATACCAAAGAGATGATAAACTCTTTACTTCAGTGACACACTGGTTTTCCTAAGCTGCACAAAAGGCTAGAAACCATGCCTCTGATGACTGGACAAAATCCAGTGGGAAACATGCTGTCATAAGCGGGGGGAGAAGCAGCAATGCTTACGAAGGAGGCACAGAAATATGCTTTGCATCGTAAGACAGGATACGGGTTTAATCTAGACACAAGGTTCTTTTTCCCCCCTTTGGTAAGGAAAGTTGGCAGAAAGTTCATTTAAACCACTTCCAAGATTTATCCTTTTTGACAATATGCTGGAGAAACTTTGAAAAATAAGTTCGAGCTGATACATATATACGTATTTTTTGATAATGTAAATAAAAGTCACATATTAATCCACCCTGTACTGCTTTAAGTGAATATACTTTGGAAAAACATTTGTTAGCTAAGAGAGATGGCTTTAAAAACAAAAACAAAACAGGAATGTAAATGTCTATTTTACTAGAAATGACAAGTTTTTTTATTTTTCTTTAATGAAAAACGAAATTTAAGATAGGCTGATGACAAAGTATTTGTCTTGAGTAATGGGCATTTTTAAGTATGATCCTCATCCTTCCCCGGCAAAGTCCCAGCCTATTATAGTAAGGGTTGGAGTCAGTATACACTCATTGGAAAGTGACATTCTAGTCATAGGGAGAGGGTGTTAGAGACCTAGTCCAATATTTTTCTTTAAAGAGAAAACCTGAAGCCCAGAAAGATAAGTGACTTGGCCAAAATCATGTGGTTAGCGACAGAAACCGGATTAAAACATGTGCTGGAAGACTGTCCAGTGTCGTGTGCCTCAGAACCAAATTAAAGACAGGCACCAGAATGACACAGAGGGCTGAATTCCCTTCTCAAATCCTATCTTGCAGCAAGGCTAGGGAGGGCATGAAGACAAAAACAGAAACCTTACTGGTCTTCCACATTCTGAGTTATTTAGGTCTAAGACTTAAATGAACAATTCTGTTGGGGGAAAAAGAAAGTTTTGAATGAGCTTTTATATGATCTGCTACTAGCAGGACTAAGGATCCAGAGGAACAAGACAGGGGAAGGCAGAGGGACAAGAGTAAAGCAAAGGCATCTCTTTCATCATTGTCACCAGCTGATTCACTGAGGTTTGGTGAAAACCCAACACTGGGTGAAAGAAGGCGATTATCACTTGATGTGGGTCTTTTCTGTTATTCGTGAATTTTAAGCAGTTTGCCCAGGAGACTGG