Transcript asmbl_21117

Sequence
Transcript Sequence for observation asmbl_21117 of TGE0004210:
TTCCGGTCCGGGGGAAGCCGTGCGAGAACCGTCACGTTAGAGCCCGGTTTCTTCTTGGCGGACAGAAATGGACTCAGAAATCAAGGAGGAAATTCCCGTGCATGACGAATACGTTTTATGTGGCGGAGCTGAAACCTGCGTTCTGAAGTGTGGGCCCTGGACTGACCTGTTTAATGATCAGAGCGCCAGCAGACCTAAGCTGCTCATTTTCATTATTCCTGGTAACCCAGGTTTGCCTGCCTTTTATGTACCATTTGCAAAGGCTTTGTACTCTTCAGTAAACAGACGCTTTCCAGTGTGGGTTATCAGTCATGCTGGGCATGTTTTGGCTCCCCAAGACAAGAAGATTCTTACAACCTCGGATGATCCAAATGCTCAAGAAATTAAGGACATCTACGGACTCCGTGGTCAAATAGAACACAAGATAACTTTCCTGAGAACTCATGTGCCAAAGGAAACGAAACTGGTGGTCATTGGCCATTCAGTAGGCTCCTATATTTCCCTTCAGATTTTGAAGCATGCCCCCGAGCTCCCAATAATTCGCTCCTTCCTGCTCTTTCCAACAATTGAGAGACTATCTGAGTCACCCAACGGCAGAATCGCCACTCCGTTATTATGCTGGTTTCGATATGTTTTAAATGTTTTTAGCTACTTGTTATTTAAACCATGTCCGGAGAAAATCAAGTCCTGGTTGCTCAGGACGAGCTGTCAGATAATGAACCTGCAGGATGAATGTTCAGTCCAGAATGTGTTGGAACCTTTCTGCCTTGTTAATATTGCCTATCTCGGTGGCCAAGAAATGATGGAGATAGTAAAGAGAGACAACGAAACCATAAAGGAACATTTGTCTAAGCTTACATTCTACTATGGTGCTAAAGATGCTTGGTGTCCAAAAGAGTACTATGAAGACATAAAGAAAGACTTCCCAGAAGGAGATATTCGACTCTGTGAGAAAAAAATACCTCATGCTTTTATCTTATACTCTTACCAAGAAATGGCCGACATGGTGGCAGACTGGCTTAAGGACGATCTGTCCAAAATTGAAACGGTGACAGAAGAAAACCAGGACTGATAGCTGGCACGTAGAGGCGATAAGTATACTGCCTCTTTGTAGCAAGTAGTGCACTTAGTAGGTAAATGTTTAATTTTGATGTTTAATAATCGGAGAGAAAAAAAGTGAGAACCTCTCGGCTTACAGTCTGCCCACTCCCAGTTCCCCGTGCTACAGTCTGTGGTAAACACGGTTGATGGAATATTCCATAAATTTAACCTCACCTTTTCCAGGACTCACAACATGGAGATCTAGATAGGTCTCTTCCGTTTGCACGAGACGCCCAGTGGCACAGCTTATTTTGGTAGGCAGGATCGTTGCAGACAAAAGGAAGTCTAAATTTAGTTTATTTTAACTGATTTACCTTATAGAATGGCTTCTCCTAGAGGAAATTATTAAATAACTACTAGAAAATGTAAAAGAGATCAGTGAATGTTAAGTGTATAATCAGATATGTGAAGTGTATGAGATCGTGAGAAGGACATACTCATGTACCAACAGCAGGAAGTGATGAGCCATGGATCTTGGCAGCGGACCTGGGTCTCTCTTAAGGACAGAAGTTGAAGATTAGCCCAGACTAACTTCGTAAAGGCCTTGCCTGAGATCATCAGAATCAGGCTGAATACCAGGGCAGCCTGCGCCCACCTGTTCCTACCTTGCAGTACGTCGCAGACCACCAAGTCGGCCTTTTGTCTGAACACCAGTGGCACGAGCCCAAGGAGAGCCAACATTGGGGGAGGTGCTGCTCATCCTCACCTCTGAGAAGCATCCCTGAGGAGTGTGACTCCCTCATCCACCTGCCTTAGACAGGGAATGAGGTTTGACAGCCTTTGCCCTAGTCAACTAACCAGAGAAGAGTCGTTCAAGGATCCTGACTCTGCCTCCCCACCACAAGGCAGCCAGCCAACTCTGTGCCGAGCCT